Incidental Mutation 'R7851:Csf2rb2'
ID606958
Institutional Source Beutler Lab
Gene Symbol Csf2rb2
Ensembl Gene ENSMUSG00000071714
Gene Namecolony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
SynonymsBil3, AIC2A, Il3r, Il3rb2, BetaIl3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7851 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78282507-78305721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78288937 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 350 (N350S)
Ref Sequence ENSEMBL: ENSMUSP00000094083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096356] [ENSMUST00000230115]
PDB Structure
Extracellular domains of mouse IL-3 beta receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000096356
AA Change: N350S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000094083
Gene: ENSMUSG00000071714
AA Change: N350S

DomainStartEndE-ValueType
SCOP:d1gh7a1 29 131 1e-57 SMART
FN3 137 225 3.73e-1 SMART
Pfam:IL6Ra-bind 248 342 6.3e-11 PFAM
FN3 343 425 2.83e0 SMART
transmembrane domain 445 467 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230115
AA Change: N241S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000230753
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,410,012 probably null Het
Abcc3 A T 11: 94,359,660 L905* probably null Het
Adamts9 T G 6: 92,908,706 D401A probably damaging Het
Ankmy1 T C 1: 92,871,722 K918E probably damaging Het
Arfgef3 T C 10: 18,592,286 N1722S probably damaging Het
Arhgef18 A G 8: 3,448,409 I481V possibly damaging Het
Asxl3 T C 18: 22,517,222 I756T possibly damaging Het
Atp6v0b A G 4: 117,885,865 F49S probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Cd2ap A G 17: 42,824,472 probably null Het
Cnn3 T A 3: 121,457,343 Y304N possibly damaging Het
Cnot2 G A 10: 116,537,432 S22L possibly damaging Het
Coq6 A T 12: 84,372,155 H311L possibly damaging Het
Dhrs9 T A 2: 69,401,256 N253K probably benign Het
Dok7 T A 5: 35,056,936 M1K probably null Het
Eogt T A 6: 97,120,201 E313D probably benign Het
Etl4 T C 2: 20,744,140 S430P probably damaging Het
Gfod2 T A 8: 105,728,130 E39D probably benign Het
Gfral T C 9: 76,205,455 N65D probably benign Het
Gsdmc4 A T 15: 63,902,746 L62* probably null Het
Gyg T G 3: 20,122,747 M360L probably benign Het
Hsp90ab1 A T 17: 45,570,452 S255T probably benign Het
Hyal6 T A 6: 24,734,498 D143E probably benign Het
Ipp C T 4: 116,515,475 Q234* probably null Het
Ism1 A T 2: 139,757,265 D386V probably damaging Het
Jrkl T C 9: 13,244,349 T436A probably benign Het
Mup3 A C 4: 62,085,257 I125S possibly damaging Het
Myh6 T A 14: 54,953,051 E1003V possibly damaging Het
Neb T A 2: 52,153,064 I6785F probably benign Het
Olfr225 T C 11: 59,613,963 V333A probably benign Het
Olfr350 T A 2: 36,850,416 Y123* probably null Het
Olfr739 A G 14: 50,425,370 T284A probably damaging Het
Olfr747 A G 14: 50,681,458 Y59H probably damaging Het
Olfr787 G T 10: 129,463,560 V295L probably benign Het
Pamr1 A T 2: 102,586,600 T86S probably benign Het
Pced1a A T 2: 130,422,316 M168K probably damaging Het
Pigs T C 11: 78,336,787 L259P probably damaging Het
Plch1 T C 3: 63,698,434 S1350G probably damaging Het
Prickle1 G A 15: 93,500,559 T796I possibly damaging Het
Ptcd3 T C 6: 71,902,859 I138M probably damaging Het
Ptprs T C 17: 56,425,482 E958G probably benign Het
Rcn3 A T 7: 45,086,812 D157E probably benign Het
Rft1 T C 14: 30,690,583 S534P probably benign Het
Ryr3 T C 2: 112,678,517 T3371A probably benign Het
Scn10a A T 9: 119,617,762 V1399D probably damaging Het
Sec61a1 T C 6: 88,512,165 T185A probably benign Het
Sgsm3 G A 15: 81,010,753 V607M probably damaging Het
Smurf2 T C 11: 106,830,926 Y581C probably damaging Het
Snx8 C A 5: 140,358,159 V101L probably damaging Het
Sp100 A T 1: 85,706,926 K180M probably benign Het
Spire2 T A 8: 123,356,699 probably null Het
St6galnac2 A G 11: 116,685,938 S86P probably benign Het
Sybu G A 15: 44,746,456 Q139* probably null Het
Tas2r114 T A 6: 131,689,925 I47F probably damaging Het
Tcf21 T C 10: 22,819,848 D19G probably benign Het
Terb2 T C 2: 122,186,313 F9L probably damaging Het
Tlr1 T C 5: 64,924,964 T757A possibly damaging Het
Tmco1 C T 1: 167,308,686 probably benign Het
Tshz3 T C 7: 36,771,589 F1001S probably damaging Het
Ttc25 C T 11: 100,545,829 T10I probably damaging Het
Vmn2r62 G A 7: 42,789,115 T99I probably benign Het
Wdr7 A T 18: 63,720,327 T33S probably benign Het
Other mutations in Csf2rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Csf2rb2 APN 15 78284847 missense possibly damaging 0.78
IGL00765:Csf2rb2 APN 15 78292716 missense probably benign 0.17
IGL01383:Csf2rb2 APN 15 78297043 missense possibly damaging 0.90
IGL01975:Csf2rb2 APN 15 78288886 missense probably benign 0.01
IGL02330:Csf2rb2 APN 15 78285128 missense possibly damaging 0.85
IGL02365:Csf2rb2 APN 15 78287060 missense possibly damaging 0.92
IGL02756:Csf2rb2 APN 15 78284849 missense possibly damaging 0.95
R0269:Csf2rb2 UTSW 15 78288865 missense probably benign 0.09
R0462:Csf2rb2 UTSW 15 78285173 missense probably damaging 1.00
R0540:Csf2rb2 UTSW 15 78287908 missense probably benign 0.00
R0607:Csf2rb2 UTSW 15 78287908 missense probably benign 0.00
R0636:Csf2rb2 UTSW 15 78291960 nonsense probably null
R0782:Csf2rb2 UTSW 15 78286751 missense probably damaging 0.98
R1387:Csf2rb2 UTSW 15 78298214 missense probably damaging 0.99
R1799:Csf2rb2 UTSW 15 78297068 missense probably damaging 1.00
R1881:Csf2rb2 UTSW 15 78292535 intron probably null
R2079:Csf2rb2 UTSW 15 78288007 missense probably benign 0.13
R2108:Csf2rb2 UTSW 15 78292544 missense probably damaging 0.99
R2359:Csf2rb2 UTSW 15 78292776 missense probably benign 0.39
R4614:Csf2rb2 UTSW 15 78291702 missense probably damaging 1.00
R4806:Csf2rb2 UTSW 15 78285290 missense probably benign 0.11
R4900:Csf2rb2 UTSW 15 78285974 splice site probably null
R5206:Csf2rb2 UTSW 15 78292752 missense probably benign
R5270:Csf2rb2 UTSW 15 78291982 splice site probably null
R5427:Csf2rb2 UTSW 15 78288911 missense probably damaging 1.00
R6633:Csf2rb2 UTSW 15 78288952 missense probably benign 0.00
R7067:Csf2rb2 UTSW 15 78292494 missense probably damaging 1.00
R7102:Csf2rb2 UTSW 15 78297072 missense probably damaging 1.00
R7117:Csf2rb2 UTSW 15 78285185 missense probably damaging 1.00
R7423:Csf2rb2 UTSW 15 78292560 missense possibly damaging 0.65
R7453:Csf2rb2 UTSW 15 78285291 missense probably benign 0.14
R7705:Csf2rb2 UTSW 15 78284574 missense probably benign 0.02
R7788:Csf2rb2 UTSW 15 78292841 missense probably benign 0.12
R7849:Csf2rb2 UTSW 15 78284421 missense probably benign 0.09
R8057:Csf2rb2 UTSW 15 78285006 missense probably damaging 0.99
RF007:Csf2rb2 UTSW 15 78291926 missense probably benign 0.21
RF009:Csf2rb2 UTSW 15 78291927 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGGTTCCCTAGAATTTCCTCTC -3'
(R):5'- GCGTTTCTCGATGATGAGGTAA -3'

Sequencing Primer
(F):5'- GGTTCCCTAGAATTTCCTCTCTTTCC -3'
(R):5'- TGTCTCCCAAGTGCTAGAACTAAAGG -3'
Posted On2019-12-20