Incidental Mutation 'R7852:S100a1'
ID606975
Institutional Source Beutler Lab
Gene Symbol S100a1
Ensembl Gene ENSMUSG00000044080
Gene NameS100 calcium binding protein A1
SynonymsS100a, S100
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7852 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location90511034-90514392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90512085 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 18 (A18S)
Ref Sequence ENSEMBL: ENSMUSP00000058237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001043] [ENSMUST00000048138] [ENSMUST00000049937] [ENSMUST00000060738] [ENSMUST00000076639] [ENSMUST00000107340] [ENSMUST00000107342] [ENSMUST00000107343] [ENSMUST00000107344] [ENSMUST00000107346] [ENSMUST00000131868] [ENSMUST00000146740]
Predicted Effect probably benign
Transcript: ENSMUST00000001043
SMART Domains Protein: ENSMUSP00000001043
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
FoP_duplication 133 221 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000048138
SMART Domains Protein: ENSMUSP00000047737
Gene: ENSMUSG00000042312

DomainStartEndE-ValueType
Pfam:S_100 71 113 4.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049937
SMART Domains Protein: ENSMUSP00000061800
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
low complexity region 111 131 N/A INTRINSIC
FoP_duplication 158 246 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060738
AA Change: A18S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058237
Gene: ENSMUSG00000044080
AA Change: A18S

DomainStartEndE-ValueType
Pfam:S_100 5 47 5.8e-23 PFAM
Pfam:EF-hand_1 54 82 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076639
SMART Domains Protein: ENSMUSP00000075936
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
Blast:FoP_duplication 59 84 3e-6 BLAST
low complexity region 86 108 N/A INTRINSIC
FoP_duplication 114 199 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107340
AA Change: A18S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102963
Gene: ENSMUSG00000044080
AA Change: A18S

DomainStartEndE-ValueType
Pfam:S_100 5 48 1.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107342
SMART Domains Protein: ENSMUSP00000102965
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Blast:FoP_duplication 34 59 3e-6 BLAST
low complexity region 61 83 N/A INTRINSIC
FoP_duplication 89 174 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107343
SMART Domains Protein: ENSMUSP00000102966
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
FoP_duplication 90 175 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107344
SMART Domains Protein: ENSMUSP00000102967
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
FoP_duplication 133 221 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107346
SMART Domains Protein: ENSMUSP00000102969
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
FoP_duplication 115 200 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131868
SMART Domains Protein: ENSMUSP00000123448
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146740
SMART Domains Protein: ENSMUSP00000116945
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 139 159 N/A INTRINSIC
low complexity region 177 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphorylation. Reduced expression of this protein has been implicated in cardiomyopathies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous and heterozygous mice exhibit a reduced cardiac contractility in response to chronic hemodynamic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
4933415A04Rik GTGT GTGTTTGT 11: 43,587,426 probably null Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Patl2 C T 2: 122,179,109 probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in S100a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1061:S100a1 UTSW 3 90511312 missense probably damaging 0.96
R1183:S100a1 UTSW 3 90511334 missense probably benign
R1766:S100a1 UTSW 3 90511292 missense probably damaging 1.00
R2282:S100a1 UTSW 3 90511292 missense probably damaging 1.00
R4615:S100a1 UTSW 3 90511255 missense possibly damaging 0.63
R5397:S100a1 UTSW 3 90512135 start codon destroyed probably null 1.00
R7935:S100a1 UTSW 3 90512085 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACATTGTGACAAGCTGGGAAC -3'
(R):5'- ATTTGAGCGAATCCAGGGCC -3'

Sequencing Primer
(F):5'- ATTTGAGTTCAAGGCCAGCC -3'
(R):5'- CAGGGCTGAAGATTTCCCTTAC -3'
Posted On2019-12-20