Incidental Mutation 'R7852:Vmn2r78'
ID 606992
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7852 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 86915300-86955177 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 86920170 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 90 (Y90*)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect probably null
Transcript: ENSMUST00000170835
AA Change: Y90*
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: Y90*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
4933415A04Rik GTGT GTGTTTGT 11: 43,587,426 probably null Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Patl2 C T 2: 122,179,109 probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86920886 missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86954305 missense possibly damaging 0.81
R9209:Vmn2r78 UTSW 7 86920223 missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGTCAACATATGAATGGGTCAC -3'
(R):5'- CCTCTGGAGTTTGGGAGAAG -3'

Sequencing Primer
(F):5'- CCAATAACCCCATGATTGG -3'
(R):5'- CCTCTGGAGTTTGGGAGAAGTACAG -3'
Posted On 2019-12-20