Incidental Mutation 'R7852:Dnajb1'
ID606999
Institutional Source Beutler Lab
Gene Symbol Dnajb1
Ensembl Gene ENSMUSG00000005483
Gene NameDnaJ heat shock protein family (Hsp40) member B1
Synonyms0610007I11Rik, Hsp40
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7852 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83608193-83612653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83610205 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 201 (D201E)
Ref Sequence ENSEMBL: ENSMUSP00000005620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005620] [ENSMUST00000212300]
Predicted Effect probably benign
Transcript: ENSMUST00000005620
AA Change: D201E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005620
Gene: ENSMUSG00000005483
AA Change: D201E

DomainStartEndE-ValueType
DnaJ 3 60 1.07e-31 SMART
low complexity region 68 91 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:DnaJ_C 164 323 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212300
AA Change: D101E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DnaJ or Hsp40 (heat shock protein 40 kD) family of proteins. The encoded protein is a molecular chaperone that stimulates the ATPase activity of Hsp70 heat-shock proteins in order to promote protein folding and prevent misfolded protein aggregation. The encoded protein may also inhibit apoptosis. Peritoneal macrophages derived from homozygous knockout mice for this gene exhibit impaired heat tolerance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and overtly normal; however, homozygous null peritoneal macrophages display impaired thermotolerance in the early (but not in the late) phase after mild heat treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
4933415A04Rik GTGT GTGTTTGT 11: 43,587,426 probably null Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Patl2 C T 2: 122,179,109 probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Dnajb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03143:Dnajb1 APN 8 83608474 missense probably damaging 0.99
R2381:Dnajb1 UTSW 8 83610342 missense possibly damaging 0.95
R5027:Dnajb1 UTSW 8 83610103 missense probably benign 0.00
R5379:Dnajb1 UTSW 8 83608506 missense possibly damaging 0.87
R7014:Dnajb1 UTSW 8 83610255 missense probably damaging 1.00
R7243:Dnajb1 UTSW 8 83610764 missense probably damaging 0.99
R7386:Dnajb1 UTSW 8 83610303 missense probably benign 0.24
R7594:Dnajb1 UTSW 8 83609844 missense probably benign
R7733:Dnajb1 UTSW 8 83608377 missense probably benign 0.11
R7935:Dnajb1 UTSW 8 83610205 missense probably benign 0.00
R8145:Dnajb1 UTSW 8 83610315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGGACATTGATGACAC -3'
(R):5'- CCTGGCTGGATAGATGACATC -3'

Sequencing Primer
(F):5'- GGCTTCACCAACATGAACTTTGG -3'
(R):5'- GATGACATCAGAACCATCTCTCTTG -3'
Posted On2019-12-20