Incidental Mutation 'R7852:Slc35f3'
ID607001
Institutional Source Beutler Lab
Gene Symbol Slc35f3
Ensembl Gene ENSMUSG00000057060
Gene Namesolute carrier family 35, member F3
SynonymsB230375D17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R7852 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location126298558-126395482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126394480 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 360 (I360T)
Ref Sequence ENSEMBL: ENSMUSP00000104390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108759]
Predicted Effect probably damaging
Transcript: ENSMUST00000108759
AA Change: I360T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104390
Gene: ENSMUSG00000057060
AA Change: I360T

DomainStartEndE-ValueType
low complexity region 25 49 N/A INTRINSIC
Pfam:EamA 67 223 3.2e-7 PFAM
Pfam:SLC35F 145 374 3.2e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
4933415A04Rik GTGT GTGTTTGT 11: 43,587,426 probably null Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Patl2 C T 2: 122,179,109 probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Slc35f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Slc35f3 APN 8 126382164 missense probably benign 0.02
IGL00956:Slc35f3 APN 8 126382224 missense probably damaging 1.00
IGL01105:Slc35f3 APN 8 126298814 missense probably damaging 1.00
IGL01710:Slc35f3 APN 8 126389161 missense probably benign 0.00
IGL01771:Slc35f3 APN 8 126389212 missense probably benign 0.00
IGL02254:Slc35f3 APN 8 126389123 missense probably damaging 1.00
IGL02610:Slc35f3 APN 8 126321217 missense probably damaging 1.00
R1666:Slc35f3 UTSW 8 126389221 missense probably damaging 0.98
R2510:Slc35f3 UTSW 8 126298706 start gained probably benign
R2520:Slc35f3 UTSW 8 126394573 missense possibly damaging 0.81
R3807:Slc35f3 UTSW 8 126389239 missense probably damaging 1.00
R4644:Slc35f3 UTSW 8 126321070 missense possibly damaging 0.87
R4675:Slc35f3 UTSW 8 126321196 nonsense probably null
R4976:Slc35f3 UTSW 8 126389281 splice site probably null
R5037:Slc35f3 UTSW 8 126389272 missense probably damaging 0.99
R5225:Slc35f3 UTSW 8 126391107 missense probably damaging 0.98
R5259:Slc35f3 UTSW 8 126389133 missense probably damaging 1.00
R5856:Slc35f3 UTSW 8 126321080 missense probably benign 0.07
R5925:Slc35f3 UTSW 8 126389207 missense probably benign 0.24
R6254:Slc35f3 UTSW 8 126321094 missense possibly damaging 0.96
R6748:Slc35f3 UTSW 8 126394638 nonsense probably null
R6785:Slc35f3 UTSW 8 126394459 missense probably benign 0.02
R7002:Slc35f3 UTSW 8 126389034 critical splice acceptor site unknown
R7291:Slc35f3 UTSW 8 126394558 missense probably benign 0.02
R7411:Slc35f3 UTSW 8 126389038 critical splice acceptor site unknown
R7456:Slc35f3 UTSW 8 126389040 critical splice acceptor site unknown
R7790:Slc35f3 UTSW 8 126389038 critical splice acceptor site unknown
R7935:Slc35f3 UTSW 8 126394480 missense probably damaging 1.00
R8000:Slc35f3 UTSW 8 126321073 missense probably benign
X0067:Slc35f3 UTSW 8 126382323 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACCAACTTACTTAGTGCTGG -3'
(R):5'- TTCTCAGCGAGCGAAGGATG -3'

Sequencing Primer
(F):5'- CTGGATTAGATTCAGATGGCGAC -3'
(R):5'- AAGGATGGGCGGGCTCTTC -3'
Posted On2019-12-20