Incidental Mutation 'R7852:Mto1'
ID607003
Institutional Source Beutler Lab
Gene Symbol Mto1
Ensembl Gene ENSMUSG00000032342
Gene Namemitochondrial tRNA translation optimization 1
Synonyms5730419A02Rik, 2310039H01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7852 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location78448208-78475348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78449538 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 112 (V112L)
Ref Sequence ENSEMBL: ENSMUSP00000034896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034896] [ENSMUST00000148238] [ENSMUST00000165499]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034896
AA Change: V112L

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034896
Gene: ENSMUSG00000032342
AA Change: V112L

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 1.3e-6 PFAM
Pfam:FAD_oxidored 37 194 2.3e-9 PFAM
Pfam:GIDA 37 435 3.5e-153 PFAM
low complexity region 518 529 N/A INTRINSIC
GIDA_assoc_3 585 658 8.31e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148238
AA Change: V112L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121424
Gene: ENSMUSG00000032342
AA Change: V112L

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 7.1e-7 PFAM
Pfam:Pyr_redox_2 37 156 2.1e-7 PFAM
Pfam:FAD_oxidored 37 178 1.1e-9 PFAM
Pfam:GIDA 37 184 8.5e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165499
SMART Domains Protein: ENSMUSP00000129088
Gene: ENSMUSG00000090317

DomainStartEndE-ValueType
low complexity region 97 111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The encoded protein may also play a role in the expression of the non-syndromic and aminoglycoside-induced deafness phenotypes associated with a specific mutation in the mitochondrial 12S rRNA gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic allele show bradycardia, cardiomyopathy, worsening of arrhythmias during induction and reversal of anesthesia, and mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
4933415A04Rik GTGT GTGTTTGT 11: 43,587,426 probably null Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Patl2 C T 2: 122,179,109 probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Vmn2r-ps130 A G 17: 23,063,814 N156S probably benign Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Mto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Mto1 APN 9 78461643 missense probably benign 0.00
IGL01362:Mto1 APN 9 78452774 missense probably benign 0.00
IGL01906:Mto1 APN 9 78464931 missense probably benign
IGL02499:Mto1 APN 9 78461512 splice site probably benign
IGL02504:Mto1 APN 9 78460927 missense probably damaging 1.00
IGL03104:Mto1 APN 9 78449520 missense probably damaging 1.00
PIT4515001:Mto1 UTSW 9 78457417 missense probably damaging 1.00
R0089:Mto1 UTSW 9 78473872 missense probably benign
R0325:Mto1 UTSW 9 78453004 missense probably damaging 1.00
R0566:Mto1 UTSW 9 78448301 missense possibly damaging 0.66
R0659:Mto1 UTSW 9 78457508 missense probably damaging 1.00
R0659:Mto1 UTSW 9 78470790 missense probably damaging 1.00
R0837:Mto1 UTSW 9 78473790 missense probably damaging 1.00
R1679:Mto1 UTSW 9 78464963 missense probably benign
R1899:Mto1 UTSW 9 78461517 splice site probably benign
R1900:Mto1 UTSW 9 78461517 splice site probably benign
R2235:Mto1 UTSW 9 78457564 missense possibly damaging 0.58
R3078:Mto1 UTSW 9 78458028 missense probably damaging 1.00
R5015:Mto1 UTSW 9 78461621 missense probably benign 0.25
R5420:Mto1 UTSW 9 78452827 missense probably benign
R5947:Mto1 UTSW 9 78461029 missense probably damaging 1.00
R5969:Mto1 UTSW 9 78452905 missense probably damaging 1.00
R6092:Mto1 UTSW 9 78460849 missense possibly damaging 0.95
R6336:Mto1 UTSW 9 78473835 missense probably damaging 0.98
R6542:Mto1 UTSW 9 78457228 missense possibly damaging 0.94
R7092:Mto1 UTSW 9 78470673 missense probably benign 0.25
R7150:Mto1 UTSW 9 78457283 missense probably damaging 1.00
R7935:Mto1 UTSW 9 78449538 missense possibly damaging 0.82
RF014:Mto1 UTSW 9 78448316 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTGATTACCTTTCCGAGCAC -3'
(R):5'- CTTCTGAACAGTGAGTAGGGG -3'

Sequencing Primer
(F):5'- ACCTTTCCGAGCACTCTTTATTAAG -3'
(R):5'- GCTCAGGATTTCTTTCTGTCAACAG -3'
Posted On2019-12-20