Incidental Mutation 'R7852:Vmn2r-ps130'
ID607024
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps130
Ensembl Gene ENSMUSG00000095658
Gene Namevomeronasal 2, receptor, pseudogene 130
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7852 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23061367-23077425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23063814 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 156 (N156S)
Ref Sequence ENSEMBL: ENSMUSP00000135186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175853]
Predicted Effect probably benign
Transcript: ENSMUST00000175853
AA Change: N156S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135186
Gene: ENSMUSG00000095658
AA Change: N156S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 76 469 5.4e-24 PFAM
Pfam:NCD3G 511 563 1.3e-21 PFAM
Pfam:7tm_3 594 831 2.1e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,696,736 S287T probably benign Het
4933415A04Rik GTGT GTGTTTGT 11: 43,587,426 probably null Het
Aco1 A G 4: 40,180,263 D388G probably benign Het
Adgrl1 T G 8: 83,935,558 L1016R probably damaging Het
Agmo C T 12: 37,242,052 P4L possibly damaging Het
Agrn A T 4: 156,169,057 H1792Q probably benign Het
Arhgef40 C T 14: 51,991,797 L615F unknown Het
Atp6v1b1 A T 6: 83,752,470 M121L possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cep152 A T 2: 125,590,113 N622K possibly damaging Het
Cfhr1 A C 1: 139,556,427 V117G probably damaging Het
Dnajb1 T A 8: 83,610,205 D201E probably benign Het
Dpysl2 T C 14: 66,862,643 N48S probably benign Het
Dsc2 A G 18: 20,046,285 I242T possibly damaging Het
Fam193a C A 5: 34,410,817 D153E probably benign Het
Flnc G T 6: 29,440,898 D332Y probably damaging Het
Fstl5 A G 3: 76,707,968 I779V probably benign Het
Gm2016 G A 12: 87,876,972 V130M unknown Het
Gm29394 T C 15: 58,048,776 I11V unknown Het
Gm36864 ATCAGAAGTTTC ATC 7: 44,236,937 probably benign Het
Gm8332 A C 12: 88,249,818 Y95D probably damaging Het
Gnpnat1 G A 14: 45,384,653 P28S probably damaging Het
Grk5 T C 19: 61,080,945 probably null Het
Gys2 A T 6: 142,430,333 F534L probably damaging Het
Igdcc4 G A 9: 65,120,258 V201I probably benign Het
Kif12 G C 4: 63,167,989 P374A probably benign Het
Krt16 A T 11: 100,246,766 I371N probably damaging Het
Lrfn2 G A 17: 49,069,944 V18I possibly damaging Het
Masp2 G A 4: 148,602,732 E24K probably benign Het
Mdga2 T C 12: 66,470,950 N37D possibly damaging Het
Med12l T A 3: 59,247,911 F1171I probably damaging Het
Med22 A T 2: 26,910,364 Y18N probably damaging Het
Mfsd4b1 T C 10: 40,003,415 N162S probably benign Het
Micu2 A T 14: 57,932,253 N213K probably benign Het
Mpc1 C T 17: 8,296,908 T86I probably damaging Het
Mto1 G T 9: 78,449,538 V112L possibly damaging Het
Napepld C T 5: 21,683,173 V93I probably benign Het
Nkx2-2 A T 2: 147,184,269 M183K probably damaging Het
Nlrp10 A G 7: 108,925,074 S400P probably damaging Het
Nynrin T C 14: 55,871,429 L1331P probably damaging Het
Ofcc1 T A 13: 40,180,439 D392V probably damaging Het
Olfr1495 A G 19: 13,768,510 H56R probably benign Het
Olfr698 A T 7: 106,752,638 M250K probably damaging Het
Olfr768 T A 10: 129,093,516 I153F probably benign Het
Olfr96 T C 17: 37,225,272 V49A probably benign Het
Patl2 C T 2: 122,179,109 probably benign Het
Pde8b T G 13: 95,107,697 D78A probably damaging Het
Pgls T A 8: 71,595,203 probably null Het
Pik3c2a A G 7: 116,417,458 S355P probably benign Het
Pole G A 5: 110,306,829 R976Q probably damaging Het
Ppip5k2 A G 1: 97,741,171 L511S probably damaging Het
Prcp A T 7: 92,928,692 N390Y probably benign Het
Rpgrip1 T A 14: 52,145,880 N752K probably benign Het
Rsl1d1 A G 16: 11,203,234 S8P probably benign Het
S100a1 C A 3: 90,512,085 A18S probably benign Het
Slc25a13 A G 6: 6,152,461 F92S probably damaging Het
Slc35f3 T C 8: 126,394,480 I360T probably damaging Het
Slc35f6 T C 5: 30,656,815 Y202H possibly damaging Het
Sox6 A T 7: 115,801,604 M1K probably null Het
Stx8 G A 11: 67,969,785 D11N probably damaging Het
Vmn2r52 T C 7: 10,158,968 Y748C probably damaging Het
Vmn2r78 T A 7: 86,920,170 Y90* probably null Het
Zc3h4 A G 7: 16,422,467 S303G unknown Het
Other mutations in Vmn2r-ps130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Vmn2r-ps130 APN 17 23076877 missense possibly damaging 0.79
IGL02346:Vmn2r-ps130 APN 17 23061527 missense possibly damaging 0.89
IGL02373:Vmn2r-ps130 APN 17 23076892 nonsense probably null
R1511:Vmn2r-ps130 UTSW 17 23063801 missense probably benign 0.17
R2373:Vmn2r-ps130 UTSW 17 23061506 missense possibly damaging 0.93
R5047:Vmn2r-ps130 UTSW 17 23063820 missense probably benign
R5317:Vmn2r-ps130 UTSW 17 23063583 missense probably benign
R5588:Vmn2r-ps130 UTSW 17 23063829 missense probably benign 0.44
R5785:Vmn2r-ps130 UTSW 17 23061487 missense probably benign
R6131:Vmn2r-ps130 UTSW 17 23063655 missense probably benign 0.00
R6273:Vmn2r-ps130 UTSW 17 23076785 missense probably benign 0.12
R6580:Vmn2r-ps130 UTSW 17 23063766 missense probably benign 0.00
R7660:Vmn2r-ps130 UTSW 17 23077032 missense probably damaging 1.00
R7935:Vmn2r-ps130 UTSW 17 23063814 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGGAACTCTGATCTTTTGCC -3'
(R):5'- GAAAGCTCCATCAAGACTCTGAATAG -3'

Sequencing Primer
(F):5'- GGAACTCTGATCTTTTGCCAAATATG -3'
(R):5'- GTACCCTTGAACTACATAGATTGGC -3'
Posted On2019-12-20