Mutagenetix > Incidental Mutation

Incidental Mutation 'R7852:Dsc2'

607027

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7852 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20046285 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 242 (I242T)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039247
AA Change: I242T

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: I242T

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075214
AA Change: I242T

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: I242T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	T	A	3: 88,696,736	S287T	probably benign	Het
4933415A04Rik	GTGT	GTGTTTGT	11: 43,587,426		probably null	Het
Aco1	A	G	4: 40,180,263	D388G	probably benign	Het
Adgrl1	T	G	8: 83,935,558	L1016R	probably damaging	Het
Agmo	C	T	12: 37,242,052	P4L	possibly damaging	Het
Agrn	A	T	4: 156,169,057	H1792Q	probably benign	Het
Arhgef40	C	T	14: 51,991,797	L615F	unknown	Het
Atp6v1b1	A	T	6: 83,752,470	M121L	possibly damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Cep152	A	T	2: 125,590,113	N622K	possibly damaging	Het
Cfhr1	A	C	1: 139,556,427	V117G	probably damaging	Het
Dnajb1	T	A	8: 83,610,205	D201E	probably benign	Het
Dpysl2	T	C	14: 66,862,643	N48S	probably benign	Het
Fam193a	C	A	5: 34,410,817	D153E	probably benign	Het
Flnc	G	T	6: 29,440,898	D332Y	probably damaging	Het
Fstl5	A	G	3: 76,707,968	I779V	probably benign	Het
Gm2016	G	A	12: 87,876,972	V130M	unknown	Het
Gm29394	T	C	15: 58,048,776	I11V	unknown	Het
Gm36864	ATCAGAAGTTTC	ATC	7: 44,236,937		probably benign	Het
Gm8332	A	C	12: 88,249,818	Y95D	probably damaging	Het
Gnpnat1	G	A	14: 45,384,653	P28S	probably damaging	Het
Grk5	T	C	19: 61,080,945		probably null	Het
Gys2	A	T	6: 142,430,333	F534L	probably damaging	Het
Igdcc4	G	A	9: 65,120,258	V201I	probably benign	Het
Kif12	G	C	4: 63,167,989	P374A	probably benign	Het
Krt16	A	T	11: 100,246,766	I371N	probably damaging	Het
Lrfn2	G	A	17: 49,069,944	V18I	possibly damaging	Het
Masp2	G	A	4: 148,602,732	E24K	probably benign	Het
Mdga2	T	C	12: 66,470,950	N37D	possibly damaging	Het
Med12l	T	A	3: 59,247,911	F1171I	probably damaging	Het
Med22	A	T	2: 26,910,364	Y18N	probably damaging	Het
Mfsd4b1	T	C	10: 40,003,415	N162S	probably benign	Het
Micu2	A	T	14: 57,932,253	N213K	probably benign	Het
Mpc1	C	T	17: 8,296,908	T86I	probably damaging	Het
Mto1	G	T	9: 78,449,538	V112L	possibly damaging	Het
Napepld	C	T	5: 21,683,173	V93I	probably benign	Het
Nkx2-2	A	T	2: 147,184,269	M183K	probably damaging	Het
Nlrp10	A	G	7: 108,925,074	S400P	probably damaging	Het
Nynrin	T	C	14: 55,871,429	L1331P	probably damaging	Het
Ofcc1	T	A	13: 40,180,439	D392V	probably damaging	Het
Olfr1495	A	G	19: 13,768,510	H56R	probably benign	Het
Olfr698	A	T	7: 106,752,638	M250K	probably damaging	Het
Olfr768	T	A	10: 129,093,516	I153F	probably benign	Het
Olfr96	T	C	17: 37,225,272	V49A	probably benign	Het
Patl2	C	T	2: 122,179,109		probably benign	Het
Pde8b	T	G	13: 95,107,697	D78A	probably damaging	Het
Pgls	T	A	8: 71,595,203		probably null	Het
Pik3c2a	A	G	7: 116,417,458	S355P	probably benign	Het
Pole	G	A	5: 110,306,829	R976Q	probably damaging	Het
Ppip5k2	A	G	1: 97,741,171	L511S	probably damaging	Het
Prcp	A	T	7: 92,928,692	N390Y	probably benign	Het
Rpgrip1	T	A	14: 52,145,880	N752K	probably benign	Het
Rsl1d1	A	G	16: 11,203,234	S8P	probably benign	Het
S100a1	C	A	3: 90,512,085	A18S	probably benign	Het
Slc25a13	A	G	6: 6,152,461	F92S	probably damaging	Het
Slc35f3	T	C	8: 126,394,480	I360T	probably damaging	Het
Slc35f6	T	C	5: 30,656,815	Y202H	possibly damaging	Het
Sox6	A	T	7: 115,801,604	M1K	probably null	Het
Stx8	G	A	11: 67,969,785	D11N	probably damaging	Het
Vmn2r52	T	C	7: 10,158,968	Y748C	probably damaging	Het
Vmn2r78	T	A	7: 86,920,170	Y90*	probably null	Het
Vmn2r-ps130	A	G	17: 23,063,814	N156S	probably benign	Het
Zc3h4	A	G	7: 16,422,467	S303G	unknown	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCTACAGATAACCCATTGGCTG -3'
(R):5'- TGAATTCCATTCCCAGCACC -3'

Sequencing Primer
(F):5'- TTGTCAAACCAAGAAACCGGTG -3'
(R):5'- TTCCATTCCCAGCACCACAAAAG -3'

Posted On

2019-12-20