Incidental Mutation 'R7853:4921509C19Rik'
ID607040
Institutional Source Beutler Lab
Gene Symbol 4921509C19Rik
Ensembl Gene ENSMUSG00000061525
Gene NameRIKEN cDNA 4921509C19 gene
SynonymsLOC381389
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7853 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location151470542-151476153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151473680 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 26 (I26T)
Ref Sequence ENSEMBL: ENSMUSP00000079030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080132]
Predicted Effect probably damaging
Transcript: ENSMUST00000080132
AA Change: I26T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079030
Gene: ENSMUSG00000061525
AA Change: I26T

DomainStartEndE-ValueType
S_TKc 24 271 2.18e-97 SMART
low complexity region 430 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,618,022 A123S probably benign Het
Adamts20 A C 15: 94,345,990 C619G probably damaging Het
Ahcyl1 C A 3: 107,668,288 V394L probably benign Het
Ankrd17 A C 5: 90,238,966 L2378V possibly damaging Het
B3gnt3 T C 8: 71,692,713 Y337C probably damaging Het
Bcl10 A G 3: 145,924,511 K18R possibly damaging Het
Calcr G A 6: 3,707,499 A267V probably benign Het
Ces1d C T 8: 93,175,067 G425S probably benign Het
Col1a1 G T 11: 94,947,679 R899L unknown Het
Commd1 C T 11: 22,956,532 R168H possibly damaging Het
Cps1 T C 1: 67,174,481 S791P possibly damaging Het
Ctsj T A 13: 61,004,070 I58F probably damaging Het
Cyp2j5 T A 4: 96,641,419 K238N probably benign Het
Dlgap4 A G 2: 156,705,882 D423G probably benign Het
Egln1 T C 8: 124,948,517 N180D probably benign Het
Ehd1 T C 19: 6,277,195 F74S probably damaging Het
Ext1 G A 15: 53,107,485 A350V probably damaging Het
Fam186b T A 15: 99,280,747 I233F probably damaging Het
Fam193a T G 5: 34,440,129 N91K probably benign Het
Far1 T A 7: 113,554,148 N329K probably damaging Het
Fhad1 A G 4: 141,909,823 S1111P probably damaging Het
Fhl2 A G 1: 43,141,824 S69P probably damaging Het
Flg2 C A 3: 93,220,747 P2322Q unknown Het
Flvcr1 A G 1: 191,025,646 Y108H probably damaging Het
Fos T A 12: 85,476,018 S235T probably benign Het
Foxf1 T A 8: 121,084,699 S101T probably damaging Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Ggps1 T C 13: 14,054,449 I50V probably benign Het
Gkn2 A G 6: 87,378,273 T155A probably benign Het
Gm49333 T A 16: 20,644,260 probably null Het
Gna12 C T 5: 140,760,694 C332Y probably damaging Het
H2-Ke6 T G 17: 34,027,437 D117A probably benign Het
Hc T A 2: 35,010,033 Y1096F probably damaging Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Ifi206 A T 1: 173,471,534 Y835* probably null Het
Ighv13-2 T G 12: 114,357,924 E65A probably damaging Het
Kif5a A T 10: 127,235,668 Y770* probably null Het
Lfng A G 5: 140,607,629 S72G probably benign Het
Lipo2 C T 19: 33,759,944 probably benign Het
Lnpep C T 17: 17,562,847 S564N probably benign Het
Mfhas1 T A 8: 35,589,871 L500* probably null Het
Mllt6 G A 11: 97,670,316 V277I probably benign Het
Mroh5 C T 15: 73,791,340 D192N probably benign Het
Myo1f T A 17: 33,576,698 V106D probably damaging Het
Mypn T A 10: 63,145,873 I643F probably benign Het
Nup188 A G 2: 30,323,563 N669D possibly damaging Het
Olfr126 C G 17: 37,850,823 T77R probably damaging Het
Olfr154 T C 2: 85,664,345 T30A probably benign Het
Olfr281 T C 15: 98,456,985 V225A probably benign Het
Olfr458 A T 6: 42,460,639 C127S probably damaging Het
Osbpl10 A G 9: 115,207,658 T241A probably damaging Het
Peg3 C T 7: 6,708,840 E1128K possibly damaging Het
Plch1 C A 3: 63,773,647 M186I probably benign Het
Pon3 A C 6: 5,236,911 L152R probably damaging Het
Prr36 G A 8: 4,213,905 P587L unknown Het
Psma2 T A 13: 14,625,247 I192N probably damaging Het
Rbm11 T C 16: 75,593,035 F30L probably damaging Het
Rpap3 G A 15: 97,678,418 A622V possibly damaging Het
Scgb2b11 T A 7: 32,209,382 N98Y probably damaging Het
Siglec1 A G 2: 131,081,292 L511P probably damaging Het
Sirpb1c C T 3: 15,832,992 V228M probably damaging Het
Smpd4 T A 16: 17,642,741 Y804N probably damaging Het
Sult6b2 T C 6: 142,801,798 D75G not run Het
Sycp3 A C 10: 88,466,506 K119N probably damaging Het
Syne2 T C 12: 76,031,504 L4703P probably damaging Het
Tex12 C G 9: 50,559,223 L20F possibly damaging Het
Them5 T A 3: 94,343,296 Y55* probably null Het
Tmem43 A T 6: 91,481,986 D213V probably benign Het
Tnfrsf10b A C 14: 69,767,790 Q44P unknown Het
Trbv2 A T 6: 41,047,902 Q84L probably benign Het
Trim2 C T 3: 84,305,230 probably benign Het
Trim36 A G 18: 46,172,491 V475A probably benign Het
Ttbk1 C A 17: 46,447,343 E788D probably benign Het
Ttn T C 2: 76,713,282 D33120G probably damaging Het
Ttn T A 2: 76,745,912 N24879I probably damaging Het
Ube4a T A 9: 44,953,010 Q76L probably benign Het
Vmn2r27 T A 6: 124,192,021 I717F probably damaging Het
Vmn2r45 T C 7: 8,482,988 K434E possibly damaging Het
Vta1 T C 10: 14,655,717 T305A probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in 4921509C19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:4921509C19Rik APN 2 151473533 missense possibly damaging 0.46
IGL02117:4921509C19Rik APN 2 151473546 missense probably benign 0.10
IGL02432:4921509C19Rik APN 2 151472561 missense probably benign 0.18
IGL03025:4921509C19Rik APN 2 151473485 missense possibly damaging 0.82
R0321:4921509C19Rik UTSW 2 151472700 missense probably benign 0.01
R0961:4921509C19Rik UTSW 2 151472766 missense probably benign 0.01
R1272:4921509C19Rik UTSW 2 151472057 missense probably damaging 0.98
R1455:4921509C19Rik UTSW 2 151472904 missense possibly damaging 0.46
R3177:4921509C19Rik UTSW 2 151472100 missense possibly damaging 0.65
R3277:4921509C19Rik UTSW 2 151472100 missense possibly damaging 0.65
R4206:4921509C19Rik UTSW 2 151473515 missense probably benign 0.44
R4655:4921509C19Rik UTSW 2 151472858 missense probably benign 0.03
R4680:4921509C19Rik UTSW 2 151473470 missense probably damaging 1.00
R4684:4921509C19Rik UTSW 2 151471871 missense unknown
R4702:4921509C19Rik UTSW 2 151472589 missense probably benign 0.00
R4867:4921509C19Rik UTSW 2 151472822 nonsense probably null
R4962:4921509C19Rik UTSW 2 151472808 missense possibly damaging 0.78
R5117:4921509C19Rik UTSW 2 151472540 missense probably benign 0.00
R5484:4921509C19Rik UTSW 2 151471931 missense probably benign
R5602:4921509C19Rik UTSW 2 151473539 missense possibly damaging 0.83
R6374:4921509C19Rik UTSW 2 151472880 missense possibly damaging 0.47
R6894:4921509C19Rik UTSW 2 151473307 missense probably damaging 1.00
R7079:4921509C19Rik UTSW 2 151473278 missense probably damaging 1.00
R7109:4921509C19Rik UTSW 2 151473753 missense probably damaging 1.00
R7155:4921509C19Rik UTSW 2 151473569 missense possibly damaging 0.69
R7441:4921509C19Rik UTSW 2 151472925 missense possibly damaging 0.51
R7845:4921509C19Rik UTSW 2 151472309 missense probably damaging 0.96
R7928:4921509C19Rik UTSW 2 151472309 missense probably damaging 0.96
R7936:4921509C19Rik UTSW 2 151473680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAACGATGAAAATGTTTCTGGTG -3'
(R):5'- GCATCATTAGATCATTTGGACCAC -3'

Sequencing Primer
(F):5'- ACGATGAAAATGTTTCTGGTGGTGTC -3'
(R):5'- TGTATTAGCACAGGAATTTAAGGC -3'
Posted On2019-12-20