Incidental Mutation 'R7853:4921509C19Rik'
ID 607040
Institutional Source Beutler Lab
Gene Symbol 4921509C19Rik
Ensembl Gene ENSMUSG00000061525
Gene Name RIKEN cDNA 4921509C19 gene
Synonyms LOC381389
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7853 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 151470542-151476153 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 151473680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 26 (I26T)
Ref Sequence ENSEMBL: ENSMUSP00000079030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080132]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080132
AA Change: I26T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079030
Gene: ENSMUSG00000061525
AA Change: I26T

DomainStartEndE-ValueType
S_TKc 24 271 2.18e-97 SMART
low complexity region 430 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,618,022 A123S probably benign Het
Adamts20 A C 15: 94,345,990 C619G probably damaging Het
Ahcyl1 C A 3: 107,668,288 V394L probably benign Het
Ankrd17 A C 5: 90,238,966 L2378V possibly damaging Het
B3gnt3 T C 8: 71,692,713 Y337C probably damaging Het
Bcl10 A G 3: 145,924,511 K18R possibly damaging Het
Calcr G A 6: 3,707,499 A267V probably benign Het
Ces1d C T 8: 93,175,067 G425S probably benign Het
Col1a1 G T 11: 94,947,679 R899L unknown Het
Commd1 C T 11: 22,956,532 R168H possibly damaging Het
Cps1 T C 1: 67,174,481 S791P possibly damaging Het
Ctsj T A 13: 61,004,070 I58F probably damaging Het
Cyp2j5 T A 4: 96,641,419 K238N probably benign Het
Dlgap4 A G 2: 156,705,882 D423G probably benign Het
Egln1 T C 8: 124,948,517 N180D probably benign Het
Ehd1 T C 19: 6,277,195 F74S probably damaging Het
Ext1 G A 15: 53,107,485 A350V probably damaging Het
Fam186b T A 15: 99,280,747 I233F probably damaging Het
Fam193a T G 5: 34,440,129 N91K probably benign Het
Far1 T A 7: 113,554,148 N329K probably damaging Het
Fhad1 A G 4: 141,909,823 S1111P probably damaging Het
Fhl2 A G 1: 43,141,824 S69P probably damaging Het
Flg2 C A 3: 93,220,747 P2322Q unknown Het
Flvcr1 A G 1: 191,025,646 Y108H probably damaging Het
Fos T A 12: 85,476,018 S235T probably benign Het
Foxf1 T A 8: 121,084,699 S101T probably damaging Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Ggps1 T C 13: 14,054,449 I50V probably benign Het
Gkn2 A G 6: 87,378,273 T155A probably benign Het
Gm49333 T A 16: 20,644,260 probably null Het
Gna12 C T 5: 140,760,694 C332Y probably damaging Het
H2-Ke6 T G 17: 34,027,437 D117A probably benign Het
Hc T A 2: 35,010,033 Y1096F probably damaging Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Ifi206 A T 1: 173,471,534 Y835* probably null Het
Ighv13-2 T G 12: 114,357,924 E65A probably damaging Het
Kif5a A T 10: 127,235,668 Y770* probably null Het
Lfng A G 5: 140,607,629 S72G probably benign Het
Lipo2 C T 19: 33,759,944 probably benign Het
Lnpep C T 17: 17,562,847 S564N probably benign Het
Mfhas1 T A 8: 35,589,871 L500* probably null Het
Mllt6 G A 11: 97,670,316 V277I probably benign Het
Mroh5 C T 15: 73,791,340 D192N probably benign Het
Myo1f T A 17: 33,576,698 V106D probably damaging Het
Mypn T A 10: 63,145,873 I643F probably benign Het
Nup188 A G 2: 30,323,563 N669D possibly damaging Het
Olfr126 C G 17: 37,850,823 T77R probably damaging Het
Olfr154 T C 2: 85,664,345 T30A probably benign Het
Olfr281 T C 15: 98,456,985 V225A probably benign Het
Olfr458 A T 6: 42,460,639 C127S probably damaging Het
Osbpl10 A G 9: 115,207,658 T241A probably damaging Het
Peg3 C T 7: 6,708,840 E1128K possibly damaging Het
Plch1 C A 3: 63,773,647 M186I probably benign Het
Pon3 A C 6: 5,236,911 L152R probably damaging Het
Prr36 G A 8: 4,213,905 P587L unknown Het
Psma2 T A 13: 14,625,247 I192N probably damaging Het
Rbm11 T C 16: 75,593,035 F30L probably damaging Het
Rpap3 G A 15: 97,678,418 A622V possibly damaging Het
Scgb2b11 T A 7: 32,209,382 N98Y probably damaging Het
Siglec1 A G 2: 131,081,292 L511P probably damaging Het
Sirpb1c C T 3: 15,832,992 V228M probably damaging Het
Smpd4 T A 16: 17,642,741 Y804N probably damaging Het
Sult6b2 T C 6: 142,801,798 D75G not run Het
Sycp3 A C 10: 88,466,506 K119N probably damaging Het
Syne2 T C 12: 76,031,504 L4703P probably damaging Het
Tex12 C G 9: 50,559,223 L20F possibly damaging Het
Them5 T A 3: 94,343,296 Y55* probably null Het
Tmem43 A T 6: 91,481,986 D213V probably benign Het
Tnfrsf10b A C 14: 69,767,790 Q44P unknown Het
Trbv2 A T 6: 41,047,902 Q84L probably benign Het
Trim2 C T 3: 84,305,230 probably benign Het
Trim36 A G 18: 46,172,491 V475A probably benign Het
Ttbk1 C A 17: 46,447,343 E788D probably benign Het
Ttn T C 2: 76,713,282 D33120G probably damaging Het
Ttn T A 2: 76,745,912 N24879I probably damaging Het
Ube4a T A 9: 44,953,010 Q76L probably benign Het
Vmn2r27 T A 6: 124,192,021 I717F probably damaging Het
Vmn2r45 T C 7: 8,482,988 K434E possibly damaging Het
Vta1 T C 10: 14,655,717 T305A probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in 4921509C19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:4921509C19Rik APN 2 151473533 missense possibly damaging 0.46
IGL02117:4921509C19Rik APN 2 151473546 missense probably benign 0.10
IGL02432:4921509C19Rik APN 2 151472561 missense probably benign 0.18
IGL03025:4921509C19Rik APN 2 151473485 missense possibly damaging 0.82
R0321:4921509C19Rik UTSW 2 151472700 missense probably benign 0.01
R0961:4921509C19Rik UTSW 2 151472766 missense probably benign 0.01
R1272:4921509C19Rik UTSW 2 151472057 missense probably damaging 0.98
R1455:4921509C19Rik UTSW 2 151472904 missense possibly damaging 0.46
R3177:4921509C19Rik UTSW 2 151472100 missense possibly damaging 0.65
R3277:4921509C19Rik UTSW 2 151472100 missense possibly damaging 0.65
R4206:4921509C19Rik UTSW 2 151473515 missense probably benign 0.44
R4655:4921509C19Rik UTSW 2 151472858 missense probably benign 0.03
R4680:4921509C19Rik UTSW 2 151473470 missense probably damaging 1.00
R4684:4921509C19Rik UTSW 2 151471871 missense unknown
R4702:4921509C19Rik UTSW 2 151472589 missense probably benign 0.00
R4867:4921509C19Rik UTSW 2 151472822 nonsense probably null
R4962:4921509C19Rik UTSW 2 151472808 missense possibly damaging 0.78
R5117:4921509C19Rik UTSW 2 151472540 missense probably benign 0.00
R5484:4921509C19Rik UTSW 2 151471931 missense probably benign
R5602:4921509C19Rik UTSW 2 151473539 missense possibly damaging 0.83
R6374:4921509C19Rik UTSW 2 151472880 missense possibly damaging 0.47
R6894:4921509C19Rik UTSW 2 151473307 missense probably damaging 1.00
R7079:4921509C19Rik UTSW 2 151473278 missense probably damaging 1.00
R7109:4921509C19Rik UTSW 2 151473753 missense probably damaging 1.00
R7155:4921509C19Rik UTSW 2 151473569 missense possibly damaging 0.69
R7441:4921509C19Rik UTSW 2 151472925 missense possibly damaging 0.51
R7845:4921509C19Rik UTSW 2 151472309 missense probably damaging 0.96
R8773:4921509C19Rik UTSW 2 151472142 missense possibly damaging 0.91
R8805:4921509C19Rik UTSW 2 151471365 splice site probably benign
R8983:4921509C19Rik UTSW 2 151471352 missense unknown
R9257:4921509C19Rik UTSW 2 151473707 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCAGAACGATGAAAATGTTTCTGGTG -3'
(R):5'- GCATCATTAGATCATTTGGACCAC -3'

Sequencing Primer
(F):5'- ACGATGAAAATGTTTCTGGTGGTGTC -3'
(R):5'- TGTATTAGCACAGGAATTTAAGGC -3'
Posted On 2019-12-20