Incidental Mutation 'R7853:Sirpb1c'
ID607042
Institutional Source Beutler Lab
Gene Symbol Sirpb1c
Ensembl Gene ENSMUSG00000074677
Gene Namesignal-regulatory protein beta 1C
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7853 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location15795145-15848528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15832992 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 228 (V228M)
Ref Sequence ENSEMBL: ENSMUSP00000103989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050623] [ENSMUST00000108349] [ENSMUST00000108350] [ENSMUST00000108352] [ENSMUST00000108354]
Predicted Effect probably damaging
Transcript: ENSMUST00000050623
AA Change: V228M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061216
Gene: ENSMUSG00000074677
AA Change: V228M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108349
AA Change: V226M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103986
Gene: ENSMUSG00000074677
AA Change: V226M

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 35 141 3.51e-8 SMART
IGc1 161 234 4.07e-4 SMART
IGc1 264 337 2.21e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108350
AA Change: V228M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103987
Gene: ENSMUSG00000074677
AA Change: V228M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108352
AA Change: V228M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103989
Gene: ENSMUSG00000074677
AA Change: V228M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108354
AA Change: V228M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103991
Gene: ENSMUSG00000074677
AA Change: V228M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000120527
Gene: ENSMUSG00000074677
AA Change: V96M

DomainStartEndE-ValueType
IGc1 32 105 4.07e-4 SMART
IGc1 135 208 2.21e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,680 I26T probably damaging Het
Aadacl4 G T 4: 144,618,022 A123S probably benign Het
Adamts20 A C 15: 94,345,990 C619G probably damaging Het
Ahcyl1 C A 3: 107,668,288 V394L probably benign Het
Ankrd17 A C 5: 90,238,966 L2378V possibly damaging Het
B3gnt3 T C 8: 71,692,713 Y337C probably damaging Het
Bcl10 A G 3: 145,924,511 K18R possibly damaging Het
Calcr G A 6: 3,707,499 A267V probably benign Het
Ces1d C T 8: 93,175,067 G425S probably benign Het
Col1a1 G T 11: 94,947,679 R899L unknown Het
Commd1 C T 11: 22,956,532 R168H possibly damaging Het
Cps1 T C 1: 67,174,481 S791P possibly damaging Het
Ctsj T A 13: 61,004,070 I58F probably damaging Het
Cyp2j5 T A 4: 96,641,419 K238N probably benign Het
Dlgap4 A G 2: 156,705,882 D423G probably benign Het
Egln1 T C 8: 124,948,517 N180D probably benign Het
Ehd1 T C 19: 6,277,195 F74S probably damaging Het
Ext1 G A 15: 53,107,485 A350V probably damaging Het
Fam186b T A 15: 99,280,747 I233F probably damaging Het
Fam193a T G 5: 34,440,129 N91K probably benign Het
Far1 T A 7: 113,554,148 N329K probably damaging Het
Fhad1 A G 4: 141,909,823 S1111P probably damaging Het
Fhl2 A G 1: 43,141,824 S69P probably damaging Het
Flg2 C A 3: 93,220,747 P2322Q unknown Het
Flvcr1 A G 1: 191,025,646 Y108H probably damaging Het
Fos T A 12: 85,476,018 S235T probably benign Het
Foxf1 T A 8: 121,084,699 S101T probably damaging Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Ggps1 T C 13: 14,054,449 I50V probably benign Het
Gkn2 A G 6: 87,378,273 T155A probably benign Het
Gm49333 T A 16: 20,644,260 probably null Het
Gna12 C T 5: 140,760,694 C332Y probably damaging Het
H2-Ke6 T G 17: 34,027,437 D117A probably benign Het
Hc T A 2: 35,010,033 Y1096F probably damaging Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Ifi206 A T 1: 173,471,534 Y835* probably null Het
Ighv13-2 T G 12: 114,357,924 E65A probably damaging Het
Kif5a A T 10: 127,235,668 Y770* probably null Het
Lfng A G 5: 140,607,629 S72G probably benign Het
Lipo2 C T 19: 33,759,944 probably benign Het
Lnpep C T 17: 17,562,847 S564N probably benign Het
Mfhas1 T A 8: 35,589,871 L500* probably null Het
Mllt6 G A 11: 97,670,316 V277I probably benign Het
Mroh5 C T 15: 73,791,340 D192N probably benign Het
Myo1f T A 17: 33,576,698 V106D probably damaging Het
Mypn T A 10: 63,145,873 I643F probably benign Het
Nup188 A G 2: 30,323,563 N669D possibly damaging Het
Olfr126 C G 17: 37,850,823 T77R probably damaging Het
Olfr154 T C 2: 85,664,345 T30A probably benign Het
Olfr281 T C 15: 98,456,985 V225A probably benign Het
Olfr458 A T 6: 42,460,639 C127S probably damaging Het
Osbpl10 A G 9: 115,207,658 T241A probably damaging Het
Peg3 C T 7: 6,708,840 E1128K possibly damaging Het
Plch1 C A 3: 63,773,647 M186I probably benign Het
Pon3 A C 6: 5,236,911 L152R probably damaging Het
Prr36 G A 8: 4,213,905 P587L unknown Het
Psma2 T A 13: 14,625,247 I192N probably damaging Het
Rbm11 T C 16: 75,593,035 F30L probably damaging Het
Rpap3 G A 15: 97,678,418 A622V possibly damaging Het
Scgb2b11 T A 7: 32,209,382 N98Y probably damaging Het
Siglec1 A G 2: 131,081,292 L511P probably damaging Het
Smpd4 T A 16: 17,642,741 Y804N probably damaging Het
Sult6b2 T C 6: 142,801,798 D75G not run Het
Sycp3 A C 10: 88,466,506 K119N probably damaging Het
Syne2 T C 12: 76,031,504 L4703P probably damaging Het
Tex12 C G 9: 50,559,223 L20F possibly damaging Het
Them5 T A 3: 94,343,296 Y55* probably null Het
Tmem43 A T 6: 91,481,986 D213V probably benign Het
Tnfrsf10b A C 14: 69,767,790 Q44P unknown Het
Trbv2 A T 6: 41,047,902 Q84L probably benign Het
Trim2 C T 3: 84,305,230 probably benign Het
Trim36 A G 18: 46,172,491 V475A probably benign Het
Ttbk1 C A 17: 46,447,343 E788D probably benign Het
Ttn T C 2: 76,713,282 D33120G probably damaging Het
Ttn T A 2: 76,745,912 N24879I probably damaging Het
Ube4a T A 9: 44,953,010 Q76L probably benign Het
Vmn2r27 T A 6: 124,192,021 I717F probably damaging Het
Vmn2r45 T C 7: 8,482,988 K434E possibly damaging Het
Vta1 T C 10: 14,655,717 T305A probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in Sirpb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Sirpb1c APN 3 15838773 missense probably benign 0.06
R0094:Sirpb1c UTSW 3 15838758 missense possibly damaging 0.73
R0356:Sirpb1c UTSW 3 15833145 missense possibly damaging 0.95
R0442:Sirpb1c UTSW 3 15802546 missense probably benign 0.09
R3731:Sirpb1c UTSW 3 15833123 missense probably damaging 1.00
R4812:Sirpb1c UTSW 3 15833222 missense probably damaging 0.99
R5802:Sirpb1c UTSW 3 15832076 missense probably benign 0.00
R6315:Sirpb1c UTSW 3 15832306 missense possibly damaging 0.71
R7107:Sirpb1c UTSW 3 15838777 missense possibly damaging 0.91
R7148:Sirpb1c UTSW 3 15833059 nonsense probably null
R7349:Sirpb1c UTSW 3 15832146 critical splice donor site probably null
R7356:Sirpb1c UTSW 3 15832133 missense probably benign
R7359:Sirpb1c UTSW 3 15833225 missense probably benign 0.02
R7466:Sirpb1c UTSW 3 15832266 missense probably damaging 1.00
R7629:Sirpb1c UTSW 3 15848395 missense possibly damaging 0.86
R7720:Sirpb1c UTSW 3 15832072 missense probably benign 0.00
R7726:Sirpb1c UTSW 3 15848386 missense possibly damaging 0.92
R7886:Sirpb1c UTSW 3 15832202 missense probably benign 0.10
R7936:Sirpb1c UTSW 3 15832992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTGATCATACTCTGTGACCAC -3'
(R):5'- CTCAGCAGACAGTGGCCTTTAC -3'

Sequencing Primer
(F):5'- TCATACTCTGTGACCACCACCAAC -3'
(R):5'- ACAGTGGCCTTTACATGCAG -3'
Posted On2019-12-20