Incidental Mutation 'R7853:Flg2'
ID607045
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7853 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93220747 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 2322 (P2322Q)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: P2322Q
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: P2322Q

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,680 I26T probably damaging Het
Aadacl4 G T 4: 144,618,022 A123S probably benign Het
Adamts20 A C 15: 94,345,990 C619G probably damaging Het
Ahcyl1 C A 3: 107,668,288 V394L probably benign Het
Ankrd17 A C 5: 90,238,966 L2378V possibly damaging Het
B3gnt3 T C 8: 71,692,713 Y337C probably damaging Het
Bcl10 A G 3: 145,924,511 K18R possibly damaging Het
Calcr G A 6: 3,707,499 A267V probably benign Het
Ces1d C T 8: 93,175,067 G425S probably benign Het
Col1a1 G T 11: 94,947,679 R899L unknown Het
Commd1 C T 11: 22,956,532 R168H possibly damaging Het
Cps1 T C 1: 67,174,481 S791P possibly damaging Het
Ctsj T A 13: 61,004,070 I58F probably damaging Het
Cyp2j5 T A 4: 96,641,419 K238N probably benign Het
Dlgap4 A G 2: 156,705,882 D423G probably benign Het
Egln1 T C 8: 124,948,517 N180D probably benign Het
Ehd1 T C 19: 6,277,195 F74S probably damaging Het
Ext1 G A 15: 53,107,485 A350V probably damaging Het
Fam186b T A 15: 99,280,747 I233F probably damaging Het
Fam193a T G 5: 34,440,129 N91K probably benign Het
Far1 T A 7: 113,554,148 N329K probably damaging Het
Fhad1 A G 4: 141,909,823 S1111P probably damaging Het
Fhl2 A G 1: 43,141,824 S69P probably damaging Het
Flvcr1 A G 1: 191,025,646 Y108H probably damaging Het
Fos T A 12: 85,476,018 S235T probably benign Het
Foxf1 T A 8: 121,084,699 S101T probably damaging Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Ggps1 T C 13: 14,054,449 I50V probably benign Het
Gkn2 A G 6: 87,378,273 T155A probably benign Het
Gm49333 T A 16: 20,644,260 probably null Het
Gna12 C T 5: 140,760,694 C332Y probably damaging Het
H2-Ke6 T G 17: 34,027,437 D117A probably benign Het
Hc T A 2: 35,010,033 Y1096F probably damaging Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Ifi206 A T 1: 173,471,534 Y835* probably null Het
Ighv13-2 T G 12: 114,357,924 E65A probably damaging Het
Kif5a A T 10: 127,235,668 Y770* probably null Het
Lfng A G 5: 140,607,629 S72G probably benign Het
Lipo2 C T 19: 33,759,944 probably benign Het
Lnpep C T 17: 17,562,847 S564N probably benign Het
Mfhas1 T A 8: 35,589,871 L500* probably null Het
Mllt6 G A 11: 97,670,316 V277I probably benign Het
Mroh5 C T 15: 73,791,340 D192N probably benign Het
Myo1f T A 17: 33,576,698 V106D probably damaging Het
Mypn T A 10: 63,145,873 I643F probably benign Het
Nup188 A G 2: 30,323,563 N669D possibly damaging Het
Olfr126 C G 17: 37,850,823 T77R probably damaging Het
Olfr154 T C 2: 85,664,345 T30A probably benign Het
Olfr281 T C 15: 98,456,985 V225A probably benign Het
Olfr458 A T 6: 42,460,639 C127S probably damaging Het
Osbpl10 A G 9: 115,207,658 T241A probably damaging Het
Peg3 C T 7: 6,708,840 E1128K possibly damaging Het
Plch1 C A 3: 63,773,647 M186I probably benign Het
Pon3 A C 6: 5,236,911 L152R probably damaging Het
Prr36 G A 8: 4,213,905 P587L unknown Het
Psma2 T A 13: 14,625,247 I192N probably damaging Het
Rbm11 T C 16: 75,593,035 F30L probably damaging Het
Rpap3 G A 15: 97,678,418 A622V possibly damaging Het
Scgb2b11 T A 7: 32,209,382 N98Y probably damaging Het
Siglec1 A G 2: 131,081,292 L511P probably damaging Het
Sirpb1c C T 3: 15,832,992 V228M probably damaging Het
Smpd4 T A 16: 17,642,741 Y804N probably damaging Het
Sult6b2 T C 6: 142,801,798 D75G not run Het
Sycp3 A C 10: 88,466,506 K119N probably damaging Het
Syne2 T C 12: 76,031,504 L4703P probably damaging Het
Tex12 C G 9: 50,559,223 L20F possibly damaging Het
Them5 T A 3: 94,343,296 Y55* probably null Het
Tmem43 A T 6: 91,481,986 D213V probably benign Het
Tnfrsf10b A C 14: 69,767,790 Q44P unknown Het
Trbv2 A T 6: 41,047,902 Q84L probably benign Het
Trim2 C T 3: 84,305,230 probably benign Het
Trim36 A G 18: 46,172,491 V475A probably benign Het
Ttbk1 C A 17: 46,447,343 E788D probably benign Het
Ttn T C 2: 76,713,282 D33120G probably damaging Het
Ttn T A 2: 76,745,912 N24879I probably damaging Het
Ube4a T A 9: 44,953,010 Q76L probably benign Het
Vmn2r27 T A 6: 124,192,021 I717F probably damaging Het
Vmn2r45 T C 7: 8,482,988 K434E possibly damaging Het
Vta1 T C 10: 14,655,717 T305A probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7936:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- TATACTGCATTGGAACTGAACAGTG -3'
(R):5'- GTAGACCTACAAACAGATCTTGCAC -3'

Sequencing Primer
(F):5'- AGTGTATATATTTACCAAGTGCAACC -3'
(R):5'- TACAAACAGATCTTGCACCAAAC -3'
Posted On2019-12-20