Incidental Mutation 'R7853:Peg3'
ID607065
Institutional Source Beutler Lab
Gene Symbol Peg3
Ensembl Gene ENSMUSG00000002265
Gene Namepaternally expressed 3
SynonymsZfp102, Gcap4, Pw1, End4
MMRRC Submission
Accession Numbers

Genbank: NM_008817; MGI: 104748

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7853 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location6703892-6730431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6708840 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1128 (E1128K)
Ref Sequence ENSEMBL: ENSMUSP00000050750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051209] [ENSMUST00000143703] [ENSMUST00000150182]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051209
AA Change: E1128K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050750
Gene: ENSMUSG00000002265
AA Change: E1128K

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
ZnF_C2H2 325 347 7.26e-3 SMART
ZnF_C2H2 378 400 6.88e-4 SMART
ZnF_C2H2 436 458 2.95e-3 SMART
low complexity region 464 496 N/A INTRINSIC
ZnF_C2H2 520 542 5.99e-4 SMART
low complexity region 691 698 N/A INTRINSIC
ZnF_C2H2 850 872 2.99e-4 SMART
ZnF_C2H2 1091 1113 2.05e-2 SMART
ZnF_C2H2 1147 1169 1.04e-3 SMART
ZnF_C2H2 1209 1231 1.38e-3 SMART
ZnF_C2H2 1266 1289 1.89e-1 SMART
ZnF_C2H2 1317 1339 1.57e2 SMART
low complexity region 1373 1419 N/A INTRINSIC
low complexity region 1440 1486 N/A INTRINSIC
ZnF_C2H2 1488 1510 2.2e-2 SMART
ZnF_C2H2 1547 1569 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143703
SMART Domains Protein: ENSMUSP00000122423
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150182
SMART Domains Protein: ENSMUSP00000116161
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2009]
PHENOTYPE: Heterozygous mutant females exhibit growth retardation, impaired maternal behavior and diminished milk ejection, and fewer oxytocin neurons. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,680 I26T probably damaging Het
Aadacl4 G T 4: 144,618,022 A123S probably benign Het
Adamts20 A C 15: 94,345,990 C619G probably damaging Het
Ahcyl1 C A 3: 107,668,288 V394L probably benign Het
Ankrd17 A C 5: 90,238,966 L2378V possibly damaging Het
B3gnt3 T C 8: 71,692,713 Y337C probably damaging Het
Bcl10 A G 3: 145,924,511 K18R possibly damaging Het
Calcr G A 6: 3,707,499 A267V probably benign Het
Ces1d C T 8: 93,175,067 G425S probably benign Het
Col1a1 G T 11: 94,947,679 R899L unknown Het
Commd1 C T 11: 22,956,532 R168H possibly damaging Het
Cps1 T C 1: 67,174,481 S791P possibly damaging Het
Ctsj T A 13: 61,004,070 I58F probably damaging Het
Cyp2j5 T A 4: 96,641,419 K238N probably benign Het
Dlgap4 A G 2: 156,705,882 D423G probably benign Het
Egln1 T C 8: 124,948,517 N180D probably benign Het
Ehd1 T C 19: 6,277,195 F74S probably damaging Het
Ext1 G A 15: 53,107,485 A350V probably damaging Het
Fam186b T A 15: 99,280,747 I233F probably damaging Het
Fam193a T G 5: 34,440,129 N91K probably benign Het
Far1 T A 7: 113,554,148 N329K probably damaging Het
Fhad1 A G 4: 141,909,823 S1111P probably damaging Het
Fhl2 A G 1: 43,141,824 S69P probably damaging Het
Flg2 C A 3: 93,220,747 P2322Q unknown Het
Flvcr1 A G 1: 191,025,646 Y108H probably damaging Het
Fos T A 12: 85,476,018 S235T probably benign Het
Foxf1 T A 8: 121,084,699 S101T probably damaging Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Ggps1 T C 13: 14,054,449 I50V probably benign Het
Gkn2 A G 6: 87,378,273 T155A probably benign Het
Gm49333 T A 16: 20,644,260 probably null Het
Gna12 C T 5: 140,760,694 C332Y probably damaging Het
H2-Ke6 T G 17: 34,027,437 D117A probably benign Het
Hc T A 2: 35,010,033 Y1096F probably damaging Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Ifi206 A T 1: 173,471,534 Y835* probably null Het
Ighv13-2 T G 12: 114,357,924 E65A probably damaging Het
Kif5a A T 10: 127,235,668 Y770* probably null Het
Lfng A G 5: 140,607,629 S72G probably benign Het
Lipo2 C T 19: 33,759,944 probably benign Het
Lnpep C T 17: 17,562,847 S564N probably benign Het
Mfhas1 T A 8: 35,589,871 L500* probably null Het
Mllt6 G A 11: 97,670,316 V277I probably benign Het
Mroh5 C T 15: 73,791,340 D192N probably benign Het
Myo1f T A 17: 33,576,698 V106D probably damaging Het
Mypn T A 10: 63,145,873 I643F probably benign Het
Nup188 A G 2: 30,323,563 N669D possibly damaging Het
Olfr126 C G 17: 37,850,823 T77R probably damaging Het
Olfr154 T C 2: 85,664,345 T30A probably benign Het
Olfr281 T C 15: 98,456,985 V225A probably benign Het
Olfr458 A T 6: 42,460,639 C127S probably damaging Het
Osbpl10 A G 9: 115,207,658 T241A probably damaging Het
Plch1 C A 3: 63,773,647 M186I probably benign Het
Pon3 A C 6: 5,236,911 L152R probably damaging Het
Prr36 G A 8: 4,213,905 P587L unknown Het
Psma2 T A 13: 14,625,247 I192N probably damaging Het
Rbm11 T C 16: 75,593,035 F30L probably damaging Het
Rpap3 G A 15: 97,678,418 A622V possibly damaging Het
Scgb2b11 T A 7: 32,209,382 N98Y probably damaging Het
Siglec1 A G 2: 131,081,292 L511P probably damaging Het
Sirpb1c C T 3: 15,832,992 V228M probably damaging Het
Smpd4 T A 16: 17,642,741 Y804N probably damaging Het
Sult6b2 T C 6: 142,801,798 D75G not run Het
Sycp3 A C 10: 88,466,506 K119N probably damaging Het
Syne2 T C 12: 76,031,504 L4703P probably damaging Het
Tex12 C G 9: 50,559,223 L20F possibly damaging Het
Them5 T A 3: 94,343,296 Y55* probably null Het
Tmem43 A T 6: 91,481,986 D213V probably benign Het
Tnfrsf10b A C 14: 69,767,790 Q44P unknown Het
Trbv2 A T 6: 41,047,902 Q84L probably benign Het
Trim2 C T 3: 84,305,230 probably benign Het
Trim36 A G 18: 46,172,491 V475A probably benign Het
Ttbk1 C A 17: 46,447,343 E788D probably benign Het
Ttn T C 2: 76,713,282 D33120G probably damaging Het
Ttn T A 2: 76,745,912 N24879I probably damaging Het
Ube4a T A 9: 44,953,010 Q76L probably benign Het
Vmn2r27 T A 6: 124,192,021 I717F probably damaging Het
Vmn2r45 T C 7: 8,482,988 K434E possibly damaging Het
Vta1 T C 10: 14,655,717 T305A probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in Peg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Peg3 APN 7 6710274 missense probably benign 0.09
IGL01410:Peg3 APN 7 6707625 missense probably benign 0.04
IGL01415:Peg3 APN 7 6711653 missense probably damaging 0.99
IGL02073:Peg3 APN 7 6711002 missense probably damaging 1.00
IGL02193:Peg3 APN 7 6711928 missense probably damaging 1.00
IGL02212:Peg3 APN 7 6711416 missense probably benign 0.41
IGL02215:Peg3 APN 7 6709011 missense probably benign 0.00
IGL02407:Peg3 APN 7 6707636 missense probably damaging 0.99
IGL02586:Peg3 APN 7 6710069 missense probably benign
IGL02673:Peg3 APN 7 6710414 missense probably damaging 1.00
IGL02935:Peg3 APN 7 6711129 missense probably damaging 1.00
IGL03277:Peg3 APN 7 6711674 missense probably damaging 1.00
IGL03330:Peg3 APN 7 6710413 missense probably damaging 1.00
IGL03393:Peg3 APN 7 6707649 missense probably damaging 0.99
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0518:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R0521:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R1477:Peg3 UTSW 7 6716142 missense probably damaging 1.00
R1716:Peg3 UTSW 7 6707781 missense possibly damaging 0.93
R1721:Peg3 UTSW 7 6709901 missense possibly damaging 0.92
R1732:Peg3 UTSW 7 6709085 missense possibly damaging 0.72
R2051:Peg3 UTSW 7 6712721 missense probably damaging 0.96
R2288:Peg3 UTSW 7 6709115 missense probably damaging 0.96
R3606:Peg3 UTSW 7 6708509 missense probably damaging 1.00
R5075:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5076:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5084:Peg3 UTSW 7 6707849 missense probably damaging 1.00
R5097:Peg3 UTSW 7 6710027 missense probably damaging 0.99
R5121:Peg3 UTSW 7 6710289 missense probably benign 0.20
R5141:Peg3 UTSW 7 6709382 missense probably benign 0.03
R5292:Peg3 UTSW 7 6708260 missense probably damaging 1.00
R5294:Peg3 UTSW 7 6717849 missense possibly damaging 0.88
R5342:Peg3 UTSW 7 6709970 missense probably damaging 1.00
R5415:Peg3 UTSW 7 6708629 missense probably benign
R5906:Peg3 UTSW 7 6717855 missense probably damaging 0.99
R6056:Peg3 UTSW 7 6709571 missense probably damaging 1.00
R6259:Peg3 UTSW 7 6709811 missense probably damaging 0.99
R6529:Peg3 UTSW 7 6708072 missense probably damaging 1.00
R6631:Peg3 UTSW 7 6709070 missense possibly damaging 0.72
R6855:Peg3 UTSW 7 6708798 missense probably benign 0.13
R6861:Peg3 UTSW 7 6711386 nonsense probably null
R6864:Peg3 UTSW 7 6712762 missense probably damaging 1.00
R6892:Peg3 UTSW 7 6708899 missense possibly damaging 0.58
R7018:Peg3 UTSW 7 6708839 missense possibly damaging 0.72
R7039:Peg3 UTSW 7 6717859 missense probably damaging 0.99
R7066:Peg3 UTSW 7 6708857 missense probably damaging 1.00
R7117:Peg3 UTSW 7 6709168 unclassified probably benign
R7133:Peg3 UTSW 7 6708945 missense probably damaging 1.00
R7493:Peg3 UTSW 7 6709724 missense probably damaging 1.00
R7539:Peg3 UTSW 7 6708168 missense probably benign 0.00
R7642:Peg3 UTSW 7 6709168 unclassified probably benign
R7646:Peg3 UTSW 7 6709222 missense probably benign
R7658:Peg3 UTSW 7 6709610 missense probably damaging 1.00
R7846:Peg3 UTSW 7 6710651 missense probably damaging 1.00
R7903:Peg3 UTSW 7 6709168 unclassified probably benign
R7913:Peg3 UTSW 7 6709168 unclassified probably benign
R7948:Peg3 UTSW 7 6708782 missense probably damaging 1.00
R8219:Peg3 UTSW 7 6708365 missense probably benign 0.00
R8385:Peg3 UTSW 7 6708083 missense probably damaging 1.00
R8672:Peg3 UTSW 7 6708524 missense possibly damaging 0.62
RF039:Peg3 UTSW 7 6709168 unclassified probably benign
YA93:Peg3 UTSW 7 6711647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGGATTCCTTTCAACAGTG -3'
(R):5'- TGCTACCATTCAGGCCTCAG -3'

Sequencing Primer
(F):5'- TTGGTCTCACGGGCAACAGAG -3'
(R):5'- GCCTCAGTTTCTGAAGAGCATCAG -3'
Posted On2019-12-20