Incidental Mutation 'R0194:Mug1'
ID 60709
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Name murinoglobulin 1
Synonyms
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0194 (G1)
Quality Score 155
Status Validated
Chromosome 6
Chromosomal Location 121815500-121866016 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121817066 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 45 (E45V)
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
AlphaFold P28665
Predicted Effect probably damaging
Transcript: ENSMUST00000032228
AA Change: E45V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: E45V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204943
Meta Mutation Damage Score 0.6925 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Cacna1h A G 17: 25,599,898 (GRCm39) probably benign Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Dntt A T 19: 41,027,409 (GRCm39) T159S possibly damaging Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam186a G A 15: 99,839,644 (GRCm39) T2200I possibly damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Jakmip1 T A 5: 37,291,627 (GRCm39) M692K possibly damaging Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Lrrc37a A G 11: 103,390,616 (GRCm39) V1603A possibly damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
Or6k4 A T 1: 173,964,327 (GRCm39) T6S probably benign Het
P3h1 T A 4: 119,095,149 (GRCm39) F302Y probably damaging Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,063,283 (GRCm39) D921G probably damaging Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
Sptbn4 G A 7: 27,104,336 (GRCm39) R962C probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Yeats2 T C 16: 19,971,719 (GRCm39) M1T probably null Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121,842,768 (GRCm39) missense probably damaging 1.00
IGL00485:Mug1 APN 6 121,864,375 (GRCm39) missense probably benign 0.17
IGL00816:Mug1 APN 6 121,859,597 (GRCm39) missense probably damaging 0.99
IGL01140:Mug1 APN 6 121,859,693 (GRCm39) missense probably benign 0.01
IGL01141:Mug1 APN 6 121,847,458 (GRCm39) missense probably benign 0.08
IGL01384:Mug1 APN 6 121,826,433 (GRCm39) splice site probably benign
IGL01659:Mug1 APN 6 121,847,619 (GRCm39) splice site probably benign
IGL02049:Mug1 APN 6 121,848,295 (GRCm39) missense probably benign
IGL02151:Mug1 APN 6 121,861,649 (GRCm39) critical splice donor site probably null
IGL02315:Mug1 APN 6 121,817,126 (GRCm39) missense probably benign
IGL02629:Mug1 APN 6 121,817,024 (GRCm39) missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121,859,544 (GRCm39) missense probably benign 0.14
IGL02807:Mug1 APN 6 121,863,531 (GRCm39) missense probably damaging 0.96
IGL02932:Mug1 APN 6 121,864,386 (GRCm39) missense probably benign 0.35
IGL03232:Mug1 APN 6 121,855,494 (GRCm39) missense probably benign 0.00
R1462_Mug1_304 UTSW 6 121,859,588 (GRCm39) missense probably benign 0.41
R2341_Mug1_749 UTSW 6 121,861,588 (GRCm39) missense probably benign 0.06
R4261_Mug1_652 UTSW 6 121,850,693 (GRCm39) missense probably benign
R6173_mug1_139 UTSW 6 121,840,752 (GRCm39) missense probably damaging 0.99
IGL03050:Mug1 UTSW 6 121,857,530 (GRCm39) missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121,861,206 (GRCm39) missense possibly damaging 0.59
R0196:Mug1 UTSW 6 121,815,684 (GRCm39) critical splice donor site probably null
R0325:Mug1 UTSW 6 121,826,801 (GRCm39) missense probably benign
R0332:Mug1 UTSW 6 121,826,856 (GRCm39) splice site probably null
R0377:Mug1 UTSW 6 121,834,320 (GRCm39) missense probably benign 0.02
R0393:Mug1 UTSW 6 121,826,809 (GRCm39) missense possibly damaging 0.64
R0414:Mug1 UTSW 6 121,833,513 (GRCm39) missense probably benign 0.00
R0457:Mug1 UTSW 6 121,838,514 (GRCm39) missense probably benign 0.06
R0479:Mug1 UTSW 6 121,817,186 (GRCm39) missense probably benign
R0519:Mug1 UTSW 6 121,828,383 (GRCm39) missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121,828,413 (GRCm39) missense probably benign
R0745:Mug1 UTSW 6 121,864,386 (GRCm39) missense probably benign 0.35
R0939:Mug1 UTSW 6 121,861,308 (GRCm39) missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121,855,498 (GRCm39) missense probably damaging 0.99
R1033:Mug1 UTSW 6 121,857,510 (GRCm39) missense probably damaging 0.99
R1086:Mug1 UTSW 6 121,862,813 (GRCm39) missense probably damaging 1.00
R1116:Mug1 UTSW 6 121,847,604 (GRCm39) missense probably benign
R1131:Mug1 UTSW 6 121,838,144 (GRCm39) missense probably benign 0.18
R1249:Mug1 UTSW 6 121,826,420 (GRCm39) missense probably benign 0.07
R1364:Mug1 UTSW 6 121,858,672 (GRCm39) missense probably damaging 1.00
R1418:Mug1 UTSW 6 121,815,635 (GRCm39) missense probably benign 0.00
R1462:Mug1 UTSW 6 121,859,588 (GRCm39) missense probably benign 0.41
R1462:Mug1 UTSW 6 121,859,588 (GRCm39) missense probably benign 0.41
R1494:Mug1 UTSW 6 121,856,259 (GRCm39) missense probably damaging 1.00
R1639:Mug1 UTSW 6 121,857,530 (GRCm39) missense probably damaging 1.00
R1901:Mug1 UTSW 6 121,858,780 (GRCm39) missense probably benign
R1902:Mug1 UTSW 6 121,858,780 (GRCm39) missense probably benign
R2087:Mug1 UTSW 6 121,833,250 (GRCm39) missense probably benign 0.00
R2168:Mug1 UTSW 6 121,847,458 (GRCm39) missense probably benign 0.08
R2249:Mug1 UTSW 6 121,847,469 (GRCm39) missense probably benign
R2341:Mug1 UTSW 6 121,861,588 (GRCm39) missense probably benign 0.06
R2888:Mug1 UTSW 6 121,858,802 (GRCm39) missense probably benign 0.44
R2892:Mug1 UTSW 6 121,817,029 (GRCm39) missense possibly damaging 0.91
R3703:Mug1 UTSW 6 121,865,515 (GRCm39) splice site probably benign
R3789:Mug1 UTSW 6 121,861,587 (GRCm39) missense probably benign 0.03
R3790:Mug1 UTSW 6 121,861,587 (GRCm39) missense probably benign 0.03
R3950:Mug1 UTSW 6 121,855,489 (GRCm39) missense probably damaging 1.00
R4261:Mug1 UTSW 6 121,850,693 (GRCm39) missense probably benign
R4402:Mug1 UTSW 6 121,856,311 (GRCm39) missense probably damaging 1.00
R4589:Mug1 UTSW 6 121,834,310 (GRCm39) missense probably benign 0.19
R4707:Mug1 UTSW 6 121,861,600 (GRCm39) missense probably damaging 1.00
R4766:Mug1 UTSW 6 121,861,213 (GRCm39) missense probably benign 0.01
R4840:Mug1 UTSW 6 121,862,813 (GRCm39) missense probably damaging 1.00
R4984:Mug1 UTSW 6 121,815,576 (GRCm39) utr 5 prime probably benign
R4999:Mug1 UTSW 6 121,855,902 (GRCm39) nonsense probably null
R5198:Mug1 UTSW 6 121,851,521 (GRCm39) missense probably damaging 1.00
R5220:Mug1 UTSW 6 121,838,092 (GRCm39) missense probably benign 0.03
R5253:Mug1 UTSW 6 121,865,872 (GRCm39) missense probably benign 0.03
R5273:Mug1 UTSW 6 121,850,748 (GRCm39) missense probably damaging 0.99
R5285:Mug1 UTSW 6 121,818,066 (GRCm39) missense probably benign 0.45
R5387:Mug1 UTSW 6 121,861,353 (GRCm39) missense probably damaging 0.99
R5560:Mug1 UTSW 6 121,838,032 (GRCm39) missense probably damaging 0.96
R5652:Mug1 UTSW 6 121,817,140 (GRCm39) missense probably benign
R5704:Mug1 UTSW 6 121,828,392 (GRCm39) missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121,855,452 (GRCm39) missense probably benign 0.00
R6053:Mug1 UTSW 6 121,842,697 (GRCm39) missense probably benign 0.00
R6173:Mug1 UTSW 6 121,840,752 (GRCm39) missense probably damaging 0.99
R6578:Mug1 UTSW 6 121,864,411 (GRCm39) missense probably benign 0.00
R6647:Mug1 UTSW 6 121,817,200 (GRCm39) missense probably benign 0.02
R6681:Mug1 UTSW 6 121,815,683 (GRCm39) missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121,858,746 (GRCm39) missense probably damaging 1.00
R7014:Mug1 UTSW 6 121,838,084 (GRCm39) missense probably benign 0.22
R7031:Mug1 UTSW 6 121,815,673 (GRCm39) missense probably benign 0.00
R7034:Mug1 UTSW 6 121,850,603 (GRCm39) missense probably benign 0.00
R7156:Mug1 UTSW 6 121,861,302 (GRCm39) missense probably damaging 1.00
R7156:Mug1 UTSW 6 121,857,864 (GRCm39) missense probably damaging 1.00
R7179:Mug1 UTSW 6 121,834,379 (GRCm39) missense probably benign 0.00
R7211:Mug1 UTSW 6 121,857,498 (GRCm39) missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121,847,611 (GRCm39) critical splice donor site probably null
R7462:Mug1 UTSW 6 121,852,399 (GRCm39) missense probably benign 0.00
R7479:Mug1 UTSW 6 121,855,467 (GRCm39) missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121,852,476 (GRCm39) missense probably damaging 1.00
R7611:Mug1 UTSW 6 121,852,387 (GRCm39) critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121,838,179 (GRCm39) missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121,833,247 (GRCm39) missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121,855,944 (GRCm39) missense possibly damaging 0.79
R7836:Mug1 UTSW 6 121,847,611 (GRCm39) critical splice donor site probably null
R7867:Mug1 UTSW 6 121,850,593 (GRCm39) missense probably benign
R7904:Mug1 UTSW 6 121,828,424 (GRCm39) missense probably benign
R7937:Mug1 UTSW 6 121,838,128 (GRCm39) missense probably benign 0.00
R7981:Mug1 UTSW 6 121,858,723 (GRCm39) missense probably damaging 1.00
R7999:Mug1 UTSW 6 121,857,855 (GRCm39) missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121,852,838 (GRCm39) missense probably benign 0.26
R8071:Mug1 UTSW 6 121,850,631 (GRCm39) missense probably benign
R8151:Mug1 UTSW 6 121,818,117 (GRCm39) missense probably benign 0.01
R8491:Mug1 UTSW 6 121,859,688 (GRCm39) missense probably damaging 1.00
R8714:Mug1 UTSW 6 121,859,681 (GRCm39) missense probably benign 0.01
R8734:Mug1 UTSW 6 121,848,340 (GRCm39) missense probably benign 0.00
R8738:Mug1 UTSW 6 121,817,208 (GRCm39) splice site probably benign
R8807:Mug1 UTSW 6 121,851,434 (GRCm39) missense probably benign 0.27
R8931:Mug1 UTSW 6 121,861,296 (GRCm39) missense probably benign
R8940:Mug1 UTSW 6 121,858,642 (GRCm39) missense
R9156:Mug1 UTSW 6 121,851,390 (GRCm39) missense probably damaging 0.99
R9314:Mug1 UTSW 6 121,834,296 (GRCm39) missense probably damaging 0.97
R9315:Mug1 UTSW 6 121,850,730 (GRCm39) missense possibly damaging 0.95
R9330:Mug1 UTSW 6 121,859,723 (GRCm39) missense probably benign 0.14
R9334:Mug1 UTSW 6 121,838,490 (GRCm39) missense probably benign 0.01
R9357:Mug1 UTSW 6 121,852,450 (GRCm39) missense probably benign 0.02
R9515:Mug1 UTSW 6 121,861,635 (GRCm39) missense probably damaging 1.00
R9549:Mug1 UTSW 6 121,858,762 (GRCm39) missense probably damaging 1.00
R9564:Mug1 UTSW 6 121,861,587 (GRCm39) missense probably benign 0.03
R9663:Mug1 UTSW 6 121,859,699 (GRCm39) missense probably benign 0.03
R9663:Mug1 UTSW 6 121,857,463 (GRCm39) missense probably benign 0.08
R9681:Mug1 UTSW 6 121,833,254 (GRCm39) missense probably benign 0.01
R9777:Mug1 UTSW 6 121,857,864 (GRCm39) missense probably damaging 1.00
RF017:Mug1 UTSW 6 121,861,533 (GRCm39) missense probably damaging 1.00
X0064:Mug1 UTSW 6 121,838,174 (GRCm39) missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121,857,452 (GRCm39) missense probably damaging 1.00
Z1176:Mug1 UTSW 6 121,818,253 (GRCm39) missense probably benign 0.32
Z1177:Mug1 UTSW 6 121,856,258 (GRCm39) critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121,840,767 (GRCm39) missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121,863,527 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGGCACACTGTGACATCTGC -3'
(R):5'- ACCCAGCCCTTACTCAGGATATCAG -3'

Sequencing Primer
(F):5'- TGTGACATCTGCCACACC -3'
(R):5'- GTATGCACAAGTATGGTCTCTTC -3'
Posted On 2013-07-24