Mutagenetix > Incidental Mutation

Incidental Mutation 'R7853:Ext1'

607093

Institutional Source

Beutler Lab

Gene Symbol

Ext1

Ensembl Gene

ENSMUSG00000061731

Gene Name

exostoses (multiple) 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7853 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53064038-53346159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 53107485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 350 (A350V)

Ref Sequence

ENSEMBL: ENSMUSP00000076505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]

AlphaFold

P97464

Predicted Effect

probably damaging
Transcript: ENSMUST00000077273
AA Change: A350V

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: A350V

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
low complexity region	29	41	N/A	INTRINSIC
Pfam:Exostosin	110	396	6e-64	PFAM
Pfam:Glyco_transf_64	480	729	1.1e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133362

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,473,680	I26T	probably damaging	Het
Aadacl4	G	T	4: 144,618,022	A123S	probably benign	Het
Adamts20	A	C	15: 94,345,990	C619G	probably damaging	Het
Ahcyl1	C	A	3: 107,668,288	V394L	probably benign	Het
Ankrd17	A	C	5: 90,238,966	L2378V	possibly damaging	Het
B3gnt3	T	C	8: 71,692,713	Y337C	probably damaging	Het
Bcl10	A	G	3: 145,924,511	K18R	possibly damaging	Het
Calcr	G	A	6: 3,707,499	A267V	probably benign	Het
Ces1d	C	T	8: 93,175,067	G425S	probably benign	Het
Col1a1	G	T	11: 94,947,679	R899L	unknown	Het
Commd1	C	T	11: 22,956,532	R168H	possibly damaging	Het
Cps1	T	C	1: 67,174,481	S791P	possibly damaging	Het
Ctsj	T	A	13: 61,004,070	I58F	probably damaging	Het
Cyp2j5	T	A	4: 96,641,419	K238N	probably benign	Het
Dlgap4	A	G	2: 156,705,882	D423G	probably benign	Het
Egln1	T	C	8: 124,948,517	N180D	probably benign	Het
Ehd1	T	C	19: 6,277,195	F74S	probably damaging	Het
Fam186b	T	A	15: 99,280,747	I233F	probably damaging	Het
Fam193a	T	G	5: 34,440,129	N91K	probably benign	Het
Far1	T	A	7: 113,554,148	N329K	probably damaging	Het
Fhad1	A	G	4: 141,909,823	S1111P	probably damaging	Het
Fhl2	A	G	1: 43,141,824	S69P	probably damaging	Het
Flg2	C	A	3: 93,220,747	P2322Q	unknown	Het
Flvcr1	A	G	1: 191,025,646	Y108H	probably damaging	Het
Fos	T	A	12: 85,476,018	S235T	probably benign	Het
Foxf1	T	A	8: 121,084,699	S101T	probably damaging	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Ggps1	T	C	13: 14,054,449	I50V	probably benign	Het
Gkn2	A	G	6: 87,378,273	T155A	probably benign	Het
Gm49333	T	A	16: 20,644,260		probably null	Het
Gna12	C	T	5: 140,760,694	C332Y	probably damaging	Het
H2-Ke6	T	G	17: 34,027,437	D117A	probably benign	Het
Hc	T	A	2: 35,010,033	Y1096F	probably damaging	Het
Hoxa3	G	A	6: 52,170,287		probably benign	Het
Ifi206	A	T	1: 173,471,534	Y835*	probably null	Het
Ighv13-2	T	G	12: 114,357,924	E65A	probably damaging	Het
Kif5a	A	T	10: 127,235,668	Y770*	probably null	Het
Lfng	A	G	5: 140,607,629	S72G	probably benign	Het
Lipo2	C	T	19: 33,759,944		probably benign	Het
Lnpep	C	T	17: 17,562,847	S564N	probably benign	Het
Mfhas1	T	A	8: 35,589,871	L500*	probably null	Het
Mllt6	G	A	11: 97,670,316	V277I	probably benign	Het
Mroh5	C	T	15: 73,791,340	D192N	probably benign	Het
Myo1f	T	A	17: 33,576,698	V106D	probably damaging	Het
Mypn	T	A	10: 63,145,873	I643F	probably benign	Het
Nup188	A	G	2: 30,323,563	N669D	possibly damaging	Het
Olfr126	C	G	17: 37,850,823	T77R	probably damaging	Het
Olfr154	T	C	2: 85,664,345	T30A	probably benign	Het
Olfr281	T	C	15: 98,456,985	V225A	probably benign	Het
Olfr458	A	T	6: 42,460,639	C127S	probably damaging	Het
Osbpl10	A	G	9: 115,207,658	T241A	probably damaging	Het
Peg3	C	T	7: 6,708,840	E1128K	possibly damaging	Het
Plch1	C	A	3: 63,773,647	M186I	probably benign	Het
Pon3	A	C	6: 5,236,911	L152R	probably damaging	Het
Prr36	G	A	8: 4,213,905	P587L	unknown	Het
Psma2	T	A	13: 14,625,247	I192N	probably damaging	Het
Rbm11	T	C	16: 75,593,035	F30L	probably damaging	Het
Rpap3	G	A	15: 97,678,418	A622V	possibly damaging	Het
Scgb2b11	T	A	7: 32,209,382	N98Y	probably damaging	Het
Siglec1	A	G	2: 131,081,292	L511P	probably damaging	Het
Sirpb1c	C	T	3: 15,832,992	V228M	probably damaging	Het
Smpd4	T	A	16: 17,642,741	Y804N	probably damaging	Het
Sult6b2	T	C	6: 142,801,798	D75G	not run	Het
Sycp3	A	C	10: 88,466,506	K119N	probably damaging	Het
Syne2	T	C	12: 76,031,504	L4703P	probably damaging	Het
Tex12	C	G	9: 50,559,223	L20F	possibly damaging	Het
Them5	T	A	3: 94,343,296	Y55*	probably null	Het
Tmem43	A	T	6: 91,481,986	D213V	probably benign	Het
Tnfrsf10b	A	C	14: 69,767,790	Q44P	unknown	Het
Trbv2	A	T	6: 41,047,902	Q84L	probably benign	Het
Trim2	C	T	3: 84,305,230		probably benign	Het
Trim36	A	G	18: 46,172,491	V475A	probably benign	Het
Ttbk1	C	A	17: 46,447,343	E788D	probably benign	Het
Ttn	T	C	2: 76,713,282	D33120G	probably damaging	Het
Ttn	T	A	2: 76,745,912	N24879I	probably damaging	Het
Ube4a	T	A	9: 44,953,010	Q76L	probably benign	Het
Vmn2r27	T	A	6: 124,192,021	I717F	probably damaging	Het
Vmn2r45	T	C	7: 8,482,988	K434E	possibly damaging	Het
Vta1	T	C	10: 14,655,717	T305A	probably damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het

Other mutations in Ext1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00710:Ext1	APN	15	53344873	missense	probably damaging	1.00
IGL02081:Ext1	APN	15	53073446	nonsense	probably null
IGL03147:Ext1	UTSW	15	53088072	missense	probably damaging	0.98
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0437:Ext1	UTSW	15	53106106	missense	probably damaging	1.00
R0881:Ext1	UTSW	15	53344483	missense	probably benign	0.23
R1882:Ext1	UTSW	15	53075792	missense	probably damaging	1.00
R2135:Ext1	UTSW	15	53101744	missense	possibly damaging	0.88
R2175:Ext1	UTSW	15	53068728	missense	probably damaging	1.00
R2762:Ext1	UTSW	15	53344927	missense	probably benign	0.29
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3752:Ext1	UTSW	15	53075910	missense	probably damaging	1.00
R3815:Ext1	UTSW	15	53345089	missense	probably benign	0.05
R4096:Ext1	UTSW	15	53073357	missense	probably damaging	1.00
R4298:Ext1	UTSW	15	53345125	missense	probably benign	0.02
R4362:Ext1	UTSW	15	53107591	intron	probably benign
R4550:Ext1	UTSW	15	53101786	missense	probably damaging	0.99
R4647:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4648:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4871:Ext1	UTSW	15	53092377	missense	probably benign	0.37
R4954:Ext1	UTSW	15	53344492	missense	probably damaging	1.00
R5010:Ext1	UTSW	15	53092412	missense	probably damaging	1.00
R5153:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5155:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5328:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5385:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5542:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5555:Ext1	UTSW	15	53088143	missense	probably damaging	1.00
R5779:Ext1	UTSW	15	53344553	missense	probably damaging	0.99
R5874:Ext1	UTSW	15	53101752	missense	possibly damaging	0.61
R6401:Ext1	UTSW	15	53106097	missense	possibly damaging	0.94
R6604:Ext1	UTSW	15	53083159	missense	probably damaging	0.99
R6847:Ext1	UTSW	15	53345154	missense	probably benign
R6885:Ext1	UTSW	15	53101692	missense	probably damaging	1.00
R7212:Ext1	UTSW	15	53345162	missense	probably benign	0.00
R7315:Ext1	UTSW	15	53073387	missense	probably damaging	1.00
R7361:Ext1	UTSW	15	53344723	missense	probably damaging	1.00
R7474:Ext1	UTSW	15	53344489	missense	probably damaging	0.98
R7860:Ext1	UTSW	15	53089939	missense	possibly damaging	0.84
R8013:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8014:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8725:Ext1	UTSW	15	53344669	missense	possibly damaging	0.91
R8888:Ext1	UTSW	15	53092327	missense	probably damaging	1.00
R9162:Ext1	UTSW	15	53345108	nonsense	probably null
R9342:Ext1	UTSW	15	53345128	missense	probably benign
R9587:Ext1	UTSW	15	53092412	missense	possibly damaging	0.53
R9663:Ext1	UTSW	15	53345060	missense	probably damaging	0.96
R9753:Ext1	UTSW	15	53344671	missense	probably damaging	1.00
X0021:Ext1	UTSW	15	53345273	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGACCGCTTACTAACTGCTCTC -3'
(R):5'- AAATTGATGCTCTGCTCTGAACC -3'

Sequencing Primer
(F):5'- TGCTCTCATGTCCAAAATCAGGGAG -3'
(R):5'- GCTCTGAACCTCCATCATCCG -3'

Posted On

2019-12-20