Incidental Mutation 'R7853:Adamts20'
ID607095
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
MMRRC Submission
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R7853 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 94345990 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 619 (C619G)
Ref Sequence ENSEMBL: ENSMUSP00000036330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000155907]
Predicted Effect probably damaging
Transcript: ENSMUST00000035342
AA Change: C619G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: C619G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155907
AA Change: C619G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: C619G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,680 I26T probably damaging Het
Aadacl4 G T 4: 144,618,022 A123S probably benign Het
Ahcyl1 C A 3: 107,668,288 V394L probably benign Het
Ankrd17 A C 5: 90,238,966 L2378V possibly damaging Het
B3gnt3 T C 8: 71,692,713 Y337C probably damaging Het
Bcl10 A G 3: 145,924,511 K18R possibly damaging Het
Calcr G A 6: 3,707,499 A267V probably benign Het
Ces1d C T 8: 93,175,067 G425S probably benign Het
Col1a1 G T 11: 94,947,679 R899L unknown Het
Commd1 C T 11: 22,956,532 R168H possibly damaging Het
Cps1 T C 1: 67,174,481 S791P possibly damaging Het
Ctsj T A 13: 61,004,070 I58F probably damaging Het
Cyp2j5 T A 4: 96,641,419 K238N probably benign Het
Dlgap4 A G 2: 156,705,882 D423G probably benign Het
Egln1 T C 8: 124,948,517 N180D probably benign Het
Ehd1 T C 19: 6,277,195 F74S probably damaging Het
Ext1 G A 15: 53,107,485 A350V probably damaging Het
Fam186b T A 15: 99,280,747 I233F probably damaging Het
Fam193a T G 5: 34,440,129 N91K probably benign Het
Far1 T A 7: 113,554,148 N329K probably damaging Het
Fhad1 A G 4: 141,909,823 S1111P probably damaging Het
Fhl2 A G 1: 43,141,824 S69P probably damaging Het
Flg2 C A 3: 93,220,747 P2322Q unknown Het
Flvcr1 A G 1: 191,025,646 Y108H probably damaging Het
Fos T A 12: 85,476,018 S235T probably benign Het
Foxf1 T A 8: 121,084,699 S101T probably damaging Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Ggps1 T C 13: 14,054,449 I50V probably benign Het
Gkn2 A G 6: 87,378,273 T155A probably benign Het
Gm49333 T A 16: 20,644,260 probably null Het
Gna12 C T 5: 140,760,694 C332Y probably damaging Het
H2-Ke6 T G 17: 34,027,437 D117A probably benign Het
Hc T A 2: 35,010,033 Y1096F probably damaging Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Ifi206 A T 1: 173,471,534 Y835* probably null Het
Ighv13-2 T G 12: 114,357,924 E65A probably damaging Het
Kif5a A T 10: 127,235,668 Y770* probably null Het
Lfng A G 5: 140,607,629 S72G probably benign Het
Lipo2 C T 19: 33,759,944 probably benign Het
Lnpep C T 17: 17,562,847 S564N probably benign Het
Mfhas1 T A 8: 35,589,871 L500* probably null Het
Mllt6 G A 11: 97,670,316 V277I probably benign Het
Mroh5 C T 15: 73,791,340 D192N probably benign Het
Myo1f T A 17: 33,576,698 V106D probably damaging Het
Mypn T A 10: 63,145,873 I643F probably benign Het
Nup188 A G 2: 30,323,563 N669D possibly damaging Het
Olfr126 C G 17: 37,850,823 T77R probably damaging Het
Olfr154 T C 2: 85,664,345 T30A probably benign Het
Olfr281 T C 15: 98,456,985 V225A probably benign Het
Olfr458 A T 6: 42,460,639 C127S probably damaging Het
Osbpl10 A G 9: 115,207,658 T241A probably damaging Het
Peg3 C T 7: 6,708,840 E1128K possibly damaging Het
Plch1 C A 3: 63,773,647 M186I probably benign Het
Pon3 A C 6: 5,236,911 L152R probably damaging Het
Prr36 G A 8: 4,213,905 P587L unknown Het
Psma2 T A 13: 14,625,247 I192N probably damaging Het
Rbm11 T C 16: 75,593,035 F30L probably damaging Het
Rpap3 G A 15: 97,678,418 A622V possibly damaging Het
Scgb2b11 T A 7: 32,209,382 N98Y probably damaging Het
Siglec1 A G 2: 131,081,292 L511P probably damaging Het
Sirpb1c C T 3: 15,832,992 V228M probably damaging Het
Smpd4 T A 16: 17,642,741 Y804N probably damaging Het
Sult6b2 T C 6: 142,801,798 D75G not run Het
Sycp3 A C 10: 88,466,506 K119N probably damaging Het
Syne2 T C 12: 76,031,504 L4703P probably damaging Het
Tex12 C G 9: 50,559,223 L20F possibly damaging Het
Them5 T A 3: 94,343,296 Y55* probably null Het
Tmem43 A T 6: 91,481,986 D213V probably benign Het
Tnfrsf10b A C 14: 69,767,790 Q44P unknown Het
Trbv2 A T 6: 41,047,902 Q84L probably benign Het
Trim2 C T 3: 84,305,230 probably benign Het
Trim36 A G 18: 46,172,491 V475A probably benign Het
Ttbk1 C A 17: 46,447,343 E788D probably benign Het
Ttn T C 2: 76,713,282 D33120G probably damaging Het
Ttn T A 2: 76,745,912 N24879I probably damaging Het
Ube4a T A 9: 44,953,010 Q76L probably benign Het
Vmn2r27 T A 6: 124,192,021 I717F probably damaging Het
Vmn2r45 T C 7: 8,482,988 K434E possibly damaging Het
Vta1 T C 10: 14,655,717 T305A probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 critical splice donor site probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 splice site probably null
IGL03088:Adamts20 APN 15 94329914 critical splice donor site probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
Meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense probably damaging 1.00
panda UTSW 15 94326699 intron probably benign
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense probably null
splotch2 UTSW 15 94335561 intron probably benign
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
whopper UTSW 15 94347810 missense probably damaging 1.00
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably null
R6419:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 splice site probably null
R6675:Adamts20 UTSW 15 94331316 critical splice donor site probably null
R6863:Adamts20 UTSW 15 94379746 nonsense probably null
R7186:Adamts20 UTSW 15 94322808 missense possibly damaging 0.76
R7263:Adamts20 UTSW 15 94322891 missense possibly damaging 0.52
R7441:Adamts20 UTSW 15 94353673 missense probably damaging 1.00
R7519:Adamts20 UTSW 15 94325988 missense possibly damaging 0.64
R7747:Adamts20 UTSW 15 94291587 nonsense probably null
R7770:Adamts20 UTSW 15 94333698 missense probably benign 0.02
R7816:Adamts20 UTSW 15 94322844 missense probably benign 0.00
R7827:Adamts20 UTSW 15 94325933 missense probably damaging 1.00
R7894:Adamts20 UTSW 15 94351760 missense probably damaging 1.00
R7951:Adamts20 UTSW 15 94341066 missense probably damaging 1.00
R8233:Adamts20 UTSW 15 94291652 missense probably benign 0.19
R8458:Adamts20 UTSW 15 94353640 missense probably benign 0.02
R8709:Adamts20 UTSW 15 94341066 missense probably damaging 1.00
R8719:Adamts20 UTSW 15 94344022 missense probably damaging 0.99
R8728:Adamts20 UTSW 15 94331400 missense probably benign 0.00
R8787:Adamts20 UTSW 15 94286413 missense possibly damaging 0.83
R8801:Adamts20 UTSW 15 94360609 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTACGGCAACTGCAAAGG -3'
(R):5'- AGAACATCTGTGGCCTTTCTGG -3'

Sequencing Primer
(F):5'- TGCAAAGGGAAGAGTCGCATTTTG -3'
(R):5'- CTGGTCCTGGCAGAGAATG -3'
Posted On2019-12-20