Incidental Mutation 'R7853:Smpd4'
ID607099
Institutional Source Beutler Lab
Gene Symbol Smpd4
Ensembl Gene ENSMUSG00000005899
Gene Namesphingomyelin phosphodiesterase 4
Synonyms4122402O22Rik, neutral membrane (neutral sphingomyelinase-3)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7853 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location17619354-17644828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17642741 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 804 (Y804N)
Ref Sequence ENSEMBL: ENSMUSP00000006053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006053] [ENSMUST00000056962] [ENSMUST00000090159] [ENSMUST00000163476] [ENSMUST00000165363] [ENSMUST00000182117] [ENSMUST00000182344] [ENSMUST00000182368] [ENSMUST00000231436] [ENSMUST00000231627] [ENSMUST00000231722] [ENSMUST00000231792] [ENSMUST00000232021] [ENSMUST00000232116] [ENSMUST00000232271]
Predicted Effect probably damaging
Transcript: ENSMUST00000006053
AA Change: Y804N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006053
Gene: ENSMUSG00000005899
AA Change: Y804N

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 768 N/A PFAM
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056962
SMART Domains Protein: ENSMUSP00000049541
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 50 105 4.1e-24 PFAM
low complexity region 154 164 N/A INTRINSIC
Pfam:CCDC74_C 209 326 1.4e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090159
AA Change: Y788N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087620
Gene: ENSMUSG00000005899
AA Change: Y788N

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.4e-177 PFAM
Pfam:mit_SMPDase 287 752 9.4e-259 PFAM
transmembrane domain 753 775 N/A INTRINSIC
transmembrane domain 782 799 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163476
AA Change: Y775N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131867
Gene: ENSMUSG00000005899
AA Change: Y775N

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 739 9.8e-266 PFAM
transmembrane domain 740 762 N/A INTRINSIC
transmembrane domain 769 786 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165363
AA Change: Y774N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130720
Gene: ENSMUSG00000005899
AA Change: Y774N

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 738 4.1e-262 PFAM
transmembrane domain 739 761 N/A INTRINSIC
transmembrane domain 768 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182117
SMART Domains Protein: ENSMUSP00000138657
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Pfam:CCDC92 36 97 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182344
SMART Domains Protein: ENSMUSP00000138131
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
Pfam:CCDC92 18 79 1.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182368
SMART Domains Protein: ENSMUSP00000138262
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 49 110 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182671
Predicted Effect probably benign
Transcript: ENSMUST00000182976
Predicted Effect probably benign
Transcript: ENSMUST00000183279
Predicted Effect probably damaging
Transcript: ENSMUST00000231436
AA Change: Y732N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000231627
Predicted Effect probably benign
Transcript: ENSMUST00000231722
Predicted Effect possibly damaging
Transcript: ENSMUST00000231792
AA Change: Y554N

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000232021
AA Change: Y702N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000232116
Predicted Effect probably damaging
Transcript: ENSMUST00000232271
AA Change: Y480N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sphingomyelinases (EC 3.1.4.12), such as SMPD4, catalyze the hydrolysis of membrane sphingomyelin to form phosphorylcholine and ceramide (Krut et al., 2006 [PubMed 16517606]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,680 I26T probably damaging Het
Aadacl4 G T 4: 144,618,022 A123S probably benign Het
Adamts20 A C 15: 94,345,990 C619G probably damaging Het
Ahcyl1 C A 3: 107,668,288 V394L probably benign Het
Ankrd17 A C 5: 90,238,966 L2378V possibly damaging Het
B3gnt3 T C 8: 71,692,713 Y337C probably damaging Het
Bcl10 A G 3: 145,924,511 K18R possibly damaging Het
Calcr G A 6: 3,707,499 A267V probably benign Het
Ces1d C T 8: 93,175,067 G425S probably benign Het
Col1a1 G T 11: 94,947,679 R899L unknown Het
Commd1 C T 11: 22,956,532 R168H possibly damaging Het
Cps1 T C 1: 67,174,481 S791P possibly damaging Het
Ctsj T A 13: 61,004,070 I58F probably damaging Het
Cyp2j5 T A 4: 96,641,419 K238N probably benign Het
Dlgap4 A G 2: 156,705,882 D423G probably benign Het
Egln1 T C 8: 124,948,517 N180D probably benign Het
Ehd1 T C 19: 6,277,195 F74S probably damaging Het
Ext1 G A 15: 53,107,485 A350V probably damaging Het
Fam186b T A 15: 99,280,747 I233F probably damaging Het
Fam193a T G 5: 34,440,129 N91K probably benign Het
Far1 T A 7: 113,554,148 N329K probably damaging Het
Fhad1 A G 4: 141,909,823 S1111P probably damaging Het
Fhl2 A G 1: 43,141,824 S69P probably damaging Het
Flg2 C A 3: 93,220,747 P2322Q unknown Het
Flvcr1 A G 1: 191,025,646 Y108H probably damaging Het
Fos T A 12: 85,476,018 S235T probably benign Het
Foxf1 T A 8: 121,084,699 S101T probably damaging Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Ggps1 T C 13: 14,054,449 I50V probably benign Het
Gkn2 A G 6: 87,378,273 T155A probably benign Het
Gm49333 T A 16: 20,644,260 probably null Het
Gna12 C T 5: 140,760,694 C332Y probably damaging Het
H2-Ke6 T G 17: 34,027,437 D117A probably benign Het
Hc T A 2: 35,010,033 Y1096F probably damaging Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Ifi206 A T 1: 173,471,534 Y835* probably null Het
Ighv13-2 T G 12: 114,357,924 E65A probably damaging Het
Kif5a A T 10: 127,235,668 Y770* probably null Het
Lfng A G 5: 140,607,629 S72G probably benign Het
Lipo2 C T 19: 33,759,944 probably benign Het
Lnpep C T 17: 17,562,847 S564N probably benign Het
Mfhas1 T A 8: 35,589,871 L500* probably null Het
Mllt6 G A 11: 97,670,316 V277I probably benign Het
Mroh5 C T 15: 73,791,340 D192N probably benign Het
Myo1f T A 17: 33,576,698 V106D probably damaging Het
Mypn T A 10: 63,145,873 I643F probably benign Het
Nup188 A G 2: 30,323,563 N669D possibly damaging Het
Olfr126 C G 17: 37,850,823 T77R probably damaging Het
Olfr154 T C 2: 85,664,345 T30A probably benign Het
Olfr281 T C 15: 98,456,985 V225A probably benign Het
Olfr458 A T 6: 42,460,639 C127S probably damaging Het
Osbpl10 A G 9: 115,207,658 T241A probably damaging Het
Peg3 C T 7: 6,708,840 E1128K possibly damaging Het
Plch1 C A 3: 63,773,647 M186I probably benign Het
Pon3 A C 6: 5,236,911 L152R probably damaging Het
Prr36 G A 8: 4,213,905 P587L unknown Het
Psma2 T A 13: 14,625,247 I192N probably damaging Het
Rbm11 T C 16: 75,593,035 F30L probably damaging Het
Rpap3 G A 15: 97,678,418 A622V possibly damaging Het
Scgb2b11 T A 7: 32,209,382 N98Y probably damaging Het
Siglec1 A G 2: 131,081,292 L511P probably damaging Het
Sirpb1c C T 3: 15,832,992 V228M probably damaging Het
Sult6b2 T C 6: 142,801,798 D75G not run Het
Sycp3 A C 10: 88,466,506 K119N probably damaging Het
Syne2 T C 12: 76,031,504 L4703P probably damaging Het
Tex12 C G 9: 50,559,223 L20F possibly damaging Het
Them5 T A 3: 94,343,296 Y55* probably null Het
Tmem43 A T 6: 91,481,986 D213V probably benign Het
Tnfrsf10b A C 14: 69,767,790 Q44P unknown Het
Trbv2 A T 6: 41,047,902 Q84L probably benign Het
Trim2 C T 3: 84,305,230 probably benign Het
Trim36 A G 18: 46,172,491 V475A probably benign Het
Ttbk1 C A 17: 46,447,343 E788D probably benign Het
Ttn T C 2: 76,713,282 D33120G probably damaging Het
Ttn T A 2: 76,745,912 N24879I probably damaging Het
Ube4a T A 9: 44,953,010 Q76L probably benign Het
Vmn2r27 T A 6: 124,192,021 I717F probably damaging Het
Vmn2r45 T C 7: 8,482,988 K434E possibly damaging Het
Vta1 T C 10: 14,655,717 T305A probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in Smpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Smpd4 APN 16 17642757 missense probably benign 0.04
IGL01461:Smpd4 APN 16 17621506 missense probably damaging 1.00
IGL02051:Smpd4 APN 16 17626518 missense probably damaging 1.00
IGL02492:Smpd4 APN 16 17639351 missense probably damaging 1.00
IGL03181:Smpd4 APN 16 17625807 nonsense probably null
Victim UTSW 16 17640971 missense probably damaging 1.00
weakling UTSW 16 17638486 intron probably benign
R0197:Smpd4 UTSW 16 17641597 critical splice donor site probably null
R0549:Smpd4 UTSW 16 17639312 missense probably benign 0.15
R0789:Smpd4 UTSW 16 17625826 missense probably benign 0.14
R1077:Smpd4 UTSW 16 17623969 missense probably damaging 1.00
R1120:Smpd4 UTSW 16 17638486 intron probably benign
R1716:Smpd4 UTSW 16 17642501 missense probably damaging 1.00
R1758:Smpd4 UTSW 16 17626008 missense probably damaging 0.99
R1758:Smpd4 UTSW 16 17640880 missense probably damaging 1.00
R1838:Smpd4 UTSW 16 17642302 splice site probably null
R2115:Smpd4 UTSW 16 17626865 missense probably benign 0.33
R2849:Smpd4 UTSW 16 17642212 missense probably damaging 1.00
R4654:Smpd4 UTSW 16 17642128 intron probably benign
R6157:Smpd4 UTSW 16 17641066 splice site probably null
R6190:Smpd4 UTSW 16 17632013 missense probably damaging 1.00
R6822:Smpd4 UTSW 16 17640233 missense probably damaging 1.00
R7062:Smpd4 UTSW 16 17640971 missense probably damaging 1.00
R7305:Smpd4 UTSW 16 17641783 missense probably damaging 0.99
R7759:Smpd4 UTSW 16 17638633 missense probably damaging 1.00
R8187:Smpd4 UTSW 16 17629135 missense probably damaging 1.00
R8303:Smpd4 UTSW 16 17639331 missense probably damaging 1.00
R8518:Smpd4 UTSW 16 17641020 missense possibly damaging 0.89
Z1176:Smpd4 UTSW 16 17619586 intron probably benign
Z1177:Smpd4 UTSW 16 17621441 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AATGACTTCCTTGGCAGCTTCTG -3'
(R):5'- CACTGCAGGGAAACTACTCC -3'

Sequencing Primer
(F):5'- GCCTTGAGCAACAGACATCTG -3'
(R):5'- TCCCAAGAACACTGAAGATGACCTG -3'
Posted On2019-12-20