Incidental Mutation 'R7853:Rbm11'
ID607101
Institutional Source Beutler Lab
Gene Symbol Rbm11
Ensembl Gene ENSMUSG00000032940
Gene NameRNA binding motif protein 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7853 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location75592844-75602829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75593035 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 30 (F30L)
Ref Sequence ENSEMBL: ENSMUSP00000109891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046378] [ENSMUST00000114249] [ENSMUST00000114253]
Predicted Effect probably damaging
Transcript: ENSMUST00000046378
AA Change: F30L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038956
Gene: ENSMUSG00000032940
AA Change: F30L

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114249
AA Change: F30L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109887
Gene: ENSMUSG00000032940
AA Change: F30L

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114253
AA Change: F30L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109891
Gene: ENSMUSG00000032940
AA Change: F30L

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,680 I26T probably damaging Het
Aadacl4 G T 4: 144,618,022 A123S probably benign Het
Adamts20 A C 15: 94,345,990 C619G probably damaging Het
Ahcyl1 C A 3: 107,668,288 V394L probably benign Het
Ankrd17 A C 5: 90,238,966 L2378V possibly damaging Het
B3gnt3 T C 8: 71,692,713 Y337C probably damaging Het
Bcl10 A G 3: 145,924,511 K18R possibly damaging Het
Calcr G A 6: 3,707,499 A267V probably benign Het
Ces1d C T 8: 93,175,067 G425S probably benign Het
Col1a1 G T 11: 94,947,679 R899L unknown Het
Commd1 C T 11: 22,956,532 R168H possibly damaging Het
Cps1 T C 1: 67,174,481 S791P possibly damaging Het
Ctsj T A 13: 61,004,070 I58F probably damaging Het
Cyp2j5 T A 4: 96,641,419 K238N probably benign Het
Dlgap4 A G 2: 156,705,882 D423G probably benign Het
Egln1 T C 8: 124,948,517 N180D probably benign Het
Ehd1 T C 19: 6,277,195 F74S probably damaging Het
Ext1 G A 15: 53,107,485 A350V probably damaging Het
Fam186b T A 15: 99,280,747 I233F probably damaging Het
Fam193a T G 5: 34,440,129 N91K probably benign Het
Far1 T A 7: 113,554,148 N329K probably damaging Het
Fhad1 A G 4: 141,909,823 S1111P probably damaging Het
Fhl2 A G 1: 43,141,824 S69P probably damaging Het
Flg2 C A 3: 93,220,747 P2322Q unknown Het
Flvcr1 A G 1: 191,025,646 Y108H probably damaging Het
Fos T A 12: 85,476,018 S235T probably benign Het
Foxf1 T A 8: 121,084,699 S101T probably damaging Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Ggps1 T C 13: 14,054,449 I50V probably benign Het
Gkn2 A G 6: 87,378,273 T155A probably benign Het
Gm49333 T A 16: 20,644,260 probably null Het
Gna12 C T 5: 140,760,694 C332Y probably damaging Het
H2-Ke6 T G 17: 34,027,437 D117A probably benign Het
Hc T A 2: 35,010,033 Y1096F probably damaging Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Ifi206 A T 1: 173,471,534 Y835* probably null Het
Ighv13-2 T G 12: 114,357,924 E65A probably damaging Het
Kif5a A T 10: 127,235,668 Y770* probably null Het
Lfng A G 5: 140,607,629 S72G probably benign Het
Lipo2 C T 19: 33,759,944 probably benign Het
Lnpep C T 17: 17,562,847 S564N probably benign Het
Mfhas1 T A 8: 35,589,871 L500* probably null Het
Mllt6 G A 11: 97,670,316 V277I probably benign Het
Mroh5 C T 15: 73,791,340 D192N probably benign Het
Myo1f T A 17: 33,576,698 V106D probably damaging Het
Mypn T A 10: 63,145,873 I643F probably benign Het
Nup188 A G 2: 30,323,563 N669D possibly damaging Het
Olfr126 C G 17: 37,850,823 T77R probably damaging Het
Olfr154 T C 2: 85,664,345 T30A probably benign Het
Olfr281 T C 15: 98,456,985 V225A probably benign Het
Olfr458 A T 6: 42,460,639 C127S probably damaging Het
Osbpl10 A G 9: 115,207,658 T241A probably damaging Het
Peg3 C T 7: 6,708,840 E1128K possibly damaging Het
Plch1 C A 3: 63,773,647 M186I probably benign Het
Pon3 A C 6: 5,236,911 L152R probably damaging Het
Prr36 G A 8: 4,213,905 P587L unknown Het
Psma2 T A 13: 14,625,247 I192N probably damaging Het
Rpap3 G A 15: 97,678,418 A622V possibly damaging Het
Scgb2b11 T A 7: 32,209,382 N98Y probably damaging Het
Siglec1 A G 2: 131,081,292 L511P probably damaging Het
Sirpb1c C T 3: 15,832,992 V228M probably damaging Het
Smpd4 T A 16: 17,642,741 Y804N probably damaging Het
Sult6b2 T C 6: 142,801,798 D75G not run Het
Sycp3 A C 10: 88,466,506 K119N probably damaging Het
Syne2 T C 12: 76,031,504 L4703P probably damaging Het
Tex12 C G 9: 50,559,223 L20F possibly damaging Het
Them5 T A 3: 94,343,296 Y55* probably null Het
Tmem43 A T 6: 91,481,986 D213V probably benign Het
Tnfrsf10b A C 14: 69,767,790 Q44P unknown Het
Trbv2 A T 6: 41,047,902 Q84L probably benign Het
Trim2 C T 3: 84,305,230 probably benign Het
Trim36 A G 18: 46,172,491 V475A probably benign Het
Ttbk1 C A 17: 46,447,343 E788D probably benign Het
Ttn T C 2: 76,713,282 D33120G probably damaging Het
Ttn T A 2: 76,745,912 N24879I probably damaging Het
Ube4a T A 9: 44,953,010 Q76L probably benign Het
Vmn2r27 T A 6: 124,192,021 I717F probably damaging Het
Vmn2r45 T C 7: 8,482,988 K434E possibly damaging Het
Vta1 T C 10: 14,655,717 T305A probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in Rbm11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Rbm11 APN 16 75600622 missense probably benign 0.01
IGL02245:Rbm11 APN 16 75593008 missense possibly damaging 0.74
IGL03350:Rbm11 APN 16 75600808 missense probably benign 0.31
R0060:Rbm11 UTSW 16 75598779 missense probably damaging 0.98
R0815:Rbm11 UTSW 16 75596637 missense probably damaging 1.00
R1351:Rbm11 UTSW 16 75596643 missense possibly damaging 0.91
R1562:Rbm11 UTSW 16 75596535 missense probably damaging 1.00
R1793:Rbm11 UTSW 16 75600797 missense probably damaging 1.00
R1891:Rbm11 UTSW 16 75600787 missense possibly damaging 0.87
R1965:Rbm11 UTSW 16 75598768 splice site probably null
R3757:Rbm11 UTSW 16 75596581 missense probably damaging 1.00
R3928:Rbm11 UTSW 16 75593044 critical splice donor site probably null
R4513:Rbm11 UTSW 16 75596587 missense probably damaging 1.00
R5314:Rbm11 UTSW 16 75596586 missense probably damaging 1.00
R5418:Rbm11 UTSW 16 75596535 missense probably damaging 1.00
R5530:Rbm11 UTSW 16 75592973 missense possibly damaging 0.66
R5891:Rbm11 UTSW 16 75598837 missense possibly damaging 0.55
R6293:Rbm11 UTSW 16 75596767 splice site probably null
R8167:Rbm11 UTSW 16 75598785 missense probably benign 0.01
R8356:Rbm11 UTSW 16 75600806 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTTCTAGTCAGGGAGGGC -3'
(R):5'- GGTGCTTACTATCCCGTGAG -3'

Sequencing Primer
(F):5'- ACGGTGGGCGTGACTTCAC -3'
(R):5'- GTGTTCCCGCAGCACATC -3'
Posted On2019-12-20