Incidental Mutation 'R7853:Trim36'
ID607108
Institutional Source Beutler Lab
Gene Symbol Trim36
Ensembl Gene ENSMUSG00000033949
Gene Nametripartite motif-containing 36
SynonymsHaprin, D18Wsu100e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R7853 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location46165302-46212607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46172491 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 475 (V475A)
Ref Sequence ENSEMBL: ENSMUSP00000037978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037011] [ENSMUST00000167364]
Predicted Effect probably benign
Transcript: ENSMUST00000037011
AA Change: V475A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037978
Gene: ENSMUSG00000033949
AA Change: V475A

DomainStartEndE-ValueType
RING 33 118 1.25e-5 SMART
BBOX 207 249 1.82e-7 SMART
Blast:BBC 256 381 5e-11 BLAST
FN3 418 498 1.32e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167364
AA Change: V463A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129771
Gene: ENSMUSG00000033949
AA Change: V463A

DomainStartEndE-ValueType
RING 21 106 1.25e-5 SMART
BBOX 195 237 1.82e-7 SMART
Blast:BBC 244 369 4e-11 BLAST
FN3 406 486 1.32e-1 SMART
Pfam:SPRY 560 704 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,680 I26T probably damaging Het
Aadacl4 G T 4: 144,618,022 A123S probably benign Het
Adamts20 A C 15: 94,345,990 C619G probably damaging Het
Ahcyl1 C A 3: 107,668,288 V394L probably benign Het
Ankrd17 A C 5: 90,238,966 L2378V possibly damaging Het
B3gnt3 T C 8: 71,692,713 Y337C probably damaging Het
Bcl10 A G 3: 145,924,511 K18R possibly damaging Het
Calcr G A 6: 3,707,499 A267V probably benign Het
Ces1d C T 8: 93,175,067 G425S probably benign Het
Col1a1 G T 11: 94,947,679 R899L unknown Het
Commd1 C T 11: 22,956,532 R168H possibly damaging Het
Cps1 T C 1: 67,174,481 S791P possibly damaging Het
Ctsj T A 13: 61,004,070 I58F probably damaging Het
Cyp2j5 T A 4: 96,641,419 K238N probably benign Het
Dlgap4 A G 2: 156,705,882 D423G probably benign Het
Egln1 T C 8: 124,948,517 N180D probably benign Het
Ehd1 T C 19: 6,277,195 F74S probably damaging Het
Ext1 G A 15: 53,107,485 A350V probably damaging Het
Fam186b T A 15: 99,280,747 I233F probably damaging Het
Fam193a T G 5: 34,440,129 N91K probably benign Het
Far1 T A 7: 113,554,148 N329K probably damaging Het
Fhad1 A G 4: 141,909,823 S1111P probably damaging Het
Fhl2 A G 1: 43,141,824 S69P probably damaging Het
Flg2 C A 3: 93,220,747 P2322Q unknown Het
Flvcr1 A G 1: 191,025,646 Y108H probably damaging Het
Fos T A 12: 85,476,018 S235T probably benign Het
Foxf1 T A 8: 121,084,699 S101T probably damaging Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Ggps1 T C 13: 14,054,449 I50V probably benign Het
Gkn2 A G 6: 87,378,273 T155A probably benign Het
Gm49333 T A 16: 20,644,260 probably null Het
Gna12 C T 5: 140,760,694 C332Y probably damaging Het
H2-Ke6 T G 17: 34,027,437 D117A probably benign Het
Hc T A 2: 35,010,033 Y1096F probably damaging Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Ifi206 A T 1: 173,471,534 Y835* probably null Het
Ighv13-2 T G 12: 114,357,924 E65A probably damaging Het
Kif5a A T 10: 127,235,668 Y770* probably null Het
Lfng A G 5: 140,607,629 S72G probably benign Het
Lipo2 C T 19: 33,759,944 probably benign Het
Lnpep C T 17: 17,562,847 S564N probably benign Het
Mfhas1 T A 8: 35,589,871 L500* probably null Het
Mllt6 G A 11: 97,670,316 V277I probably benign Het
Mroh5 C T 15: 73,791,340 D192N probably benign Het
Myo1f T A 17: 33,576,698 V106D probably damaging Het
Mypn T A 10: 63,145,873 I643F probably benign Het
Nup188 A G 2: 30,323,563 N669D possibly damaging Het
Olfr126 C G 17: 37,850,823 T77R probably damaging Het
Olfr154 T C 2: 85,664,345 T30A probably benign Het
Olfr281 T C 15: 98,456,985 V225A probably benign Het
Olfr458 A T 6: 42,460,639 C127S probably damaging Het
Osbpl10 A G 9: 115,207,658 T241A probably damaging Het
Peg3 C T 7: 6,708,840 E1128K possibly damaging Het
Plch1 C A 3: 63,773,647 M186I probably benign Het
Pon3 A C 6: 5,236,911 L152R probably damaging Het
Prr36 G A 8: 4,213,905 P587L unknown Het
Psma2 T A 13: 14,625,247 I192N probably damaging Het
Rbm11 T C 16: 75,593,035 F30L probably damaging Het
Rpap3 G A 15: 97,678,418 A622V possibly damaging Het
Scgb2b11 T A 7: 32,209,382 N98Y probably damaging Het
Siglec1 A G 2: 131,081,292 L511P probably damaging Het
Sirpb1c C T 3: 15,832,992 V228M probably damaging Het
Smpd4 T A 16: 17,642,741 Y804N probably damaging Het
Sult6b2 T C 6: 142,801,798 D75G not run Het
Sycp3 A C 10: 88,466,506 K119N probably damaging Het
Syne2 T C 12: 76,031,504 L4703P probably damaging Het
Tex12 C G 9: 50,559,223 L20F possibly damaging Het
Them5 T A 3: 94,343,296 Y55* probably null Het
Tmem43 A T 6: 91,481,986 D213V probably benign Het
Tnfrsf10b A C 14: 69,767,790 Q44P unknown Het
Trbv2 A T 6: 41,047,902 Q84L probably benign Het
Trim2 C T 3: 84,305,230 probably benign Het
Ttbk1 C A 17: 46,447,343 E788D probably benign Het
Ttn T C 2: 76,713,282 D33120G probably damaging Het
Ttn T A 2: 76,745,912 N24879I probably damaging Het
Ube4a T A 9: 44,953,010 Q76L probably benign Het
Vmn2r27 T A 6: 124,192,021 I717F probably damaging Het
Vmn2r45 T C 7: 8,482,988 K434E possibly damaging Het
Vta1 T C 10: 14,655,717 T305A probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in Trim36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Trim36 APN 18 46188388 splice site probably benign
IGL02728:Trim36 APN 18 46172602 missense probably benign 0.00
IGL03166:Trim36 APN 18 46212321 missense probably benign
IGL03209:Trim36 APN 18 46167508 missense probably benign
R0346:Trim36 UTSW 18 46199709 unclassified probably benign
R0426:Trim36 UTSW 18 46172525 missense probably damaging 0.97
R0463:Trim36 UTSW 18 46178456 missense possibly damaging 0.89
R0590:Trim36 UTSW 18 46172576 missense probably benign 0.01
R0751:Trim36 UTSW 18 46196251 missense probably damaging 1.00
R1037:Trim36 UTSW 18 46196318 splice site probably benign
R1184:Trim36 UTSW 18 46196251 missense probably damaging 1.00
R1522:Trim36 UTSW 18 46186183 nonsense probably null
R1571:Trim36 UTSW 18 46172495 missense probably benign 0.01
R1687:Trim36 UTSW 18 46188657 missense possibly damaging 0.93
R2057:Trim36 UTSW 18 46196162 missense probably benign 0.02
R2103:Trim36 UTSW 18 46196082 missense probably benign
R2127:Trim36 UTSW 18 46212337 missense probably benign 0.27
R3853:Trim36 UTSW 18 46172372 splice site probably benign
R4209:Trim36 UTSW 18 46196124 missense probably benign 0.44
R4787:Trim36 UTSW 18 46172532 missense probably benign 0.10
R4810:Trim36 UTSW 18 46172469 missense probably benign 0.07
R4953:Trim36 UTSW 18 46196178 missense possibly damaging 0.90
R5107:Trim36 UTSW 18 46172638 missense probably benign
R5320:Trim36 UTSW 18 46167498 missense probably damaging 1.00
R5683:Trim36 UTSW 18 46169292 missense probably damaging 1.00
R5823:Trim36 UTSW 18 46169340 missense probably damaging 1.00
R6619:Trim36 UTSW 18 46188408 missense probably damaging 0.96
R7349:Trim36 UTSW 18 46169428 missense probably benign 0.29
R7814:Trim36 UTSW 18 46167624 missense possibly damaging 0.64
R8008:Trim36 UTSW 18 46172489 missense probably benign 0.34
R8294:Trim36 UTSW 18 46198521 missense probably benign 0.02
R8735:Trim36 UTSW 18 46169385 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGAGACACTCTACACTTCTGG -3'
(R):5'- GGGAAATGCTGTCTTAACATCG -3'

Sequencing Primer
(F):5'- GACACTCTACACTTCTGGGCCTC -3'
(R):5'- TCAGGCATAGACATTCCTGAGATC -3'
Posted On2019-12-20