Incidental Mutation 'R7854:Dennd5b'
ID 607125
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 045907-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R7854 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148969964 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 163 (D163G)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557] [ENSMUST00000127727] [ENSMUST00000145555]
AlphaFold A2RSQ0
Predicted Effect probably benign
Transcript: ENSMUST00000111557
AA Change: D163G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: D163G

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127727
SMART Domains Protein: ENSMUSP00000123568
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 18 142 5.45e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145555
SMART Domains Protein: ENSMUSP00000127731
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 1 42 3.03e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T A 13: 81,741,207 (GRCm39) I86F probably damaging Het
Als2cl A G 9: 110,727,564 (GRCm39) *953W probably null Het
Ap1g2 A G 14: 55,343,390 (GRCm39) F66L probably damaging Het
Aqp12 T G 1: 92,934,176 (GRCm39) C18G probably damaging Het
Atp9a T C 2: 168,490,523 (GRCm39) I826V probably benign Het
C1ra A G 6: 124,494,700 (GRCm39) Q321R probably benign Het
Calcoco1 T C 15: 102,627,991 (GRCm39) I48V possibly damaging Het
Cep63 A T 9: 102,480,197 (GRCm39) S269R probably damaging Het
Chchd7 T C 4: 3,943,422 (GRCm39) V63A possibly damaging Het
Dpep2 T C 8: 106,716,160 (GRCm39) D251G Het
Ercc6 T C 14: 32,288,249 (GRCm39) L807P probably damaging Het
Fads6 A T 11: 115,188,222 (GRCm39) D27E probably benign Het
Gfer C A 17: 24,913,259 (GRCm39) D198Y probably damaging Het
Glce A T 9: 61,977,773 (GRCm39) I37N probably benign Het
Gps2 T C 11: 69,806,030 (GRCm39) L128P probably damaging Het
Gramd2b A G 18: 56,611,926 (GRCm39) T130A probably damaging Het
Hectd4 T A 5: 121,467,631 (GRCm39) Y2527N probably benign Het
Itpr1 A G 6: 108,364,330 (GRCm39) D820G probably damaging Het
Itsn2 T C 12: 4,751,276 (GRCm39) Y1289H probably damaging Het
Kcnh6 A T 11: 105,908,172 (GRCm39) I263F probably damaging Het
Kcns2 A T 15: 34,839,917 (GRCm39) M427L probably benign Het
Mptx1 A T 1: 174,159,966 (GRCm39) M91L probably benign Het
Ms4a20 T A 19: 11,089,741 (GRCm39) Y48F probably benign Het
Mtx2 A G 2: 74,699,231 (GRCm39) Y128C probably damaging Het
Myh9 A T 15: 77,675,953 (GRCm39) D244E probably benign Het
Ndufs2 T C 1: 171,066,938 (GRCm39) D140G probably damaging Het
Obscn T C 11: 58,981,538 (GRCm39) T1827A probably benign Het
Ogn A T 13: 49,774,514 (GRCm39) Y219F possibly damaging Het
Or1ak2 A G 2: 36,828,036 (GRCm39) R302G probably benign Het
Or51f2 C T 7: 102,526,992 (GRCm39) R222* probably null Het
Parp4 A G 14: 56,896,805 (GRCm39) E1943G unknown Het
Pex19 T G 1: 171,954,417 (GRCm39) probably null Het
Prss53 T C 7: 127,488,117 (GRCm39) N166S probably benign Het
Prx T A 7: 27,216,066 (GRCm39) V328E probably damaging Het
Pstpip2 C T 18: 77,962,004 (GRCm39) T258I probably benign Het
Rasgrp4 C T 7: 28,850,035 (GRCm39) P58L unknown Het
Ros1 T C 10: 52,004,563 (GRCm39) Y1019C probably damaging Het
Rptor T C 11: 119,748,779 (GRCm39) M787T probably benign Het
Rsf1 GGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCAGCGGCAGCGGCGGCGGC 7: 97,229,131 (GRCm39) probably benign Het
Spef2 T A 15: 9,596,730 (GRCm39) R1440W possibly damaging Het
Spta1 T A 1: 174,046,396 (GRCm39) probably null Het
Sptbn4 T C 7: 27,061,835 (GRCm39) I2335V probably benign Het
Srp68 G C 11: 116,144,909 (GRCm39) probably null Het
Taar1 A G 10: 23,796,680 (GRCm39) D126G probably benign Het
Tdrd9 A G 12: 112,013,395 (GRCm39) T1210A probably benign Het
Tle5 A G 10: 81,401,481 (GRCm39) H183R probably damaging Het
Tpcn1 A G 5: 120,687,653 (GRCm39) F364L probably damaging Het
Trav2 A T 14: 52,805,238 (GRCm39) K20* probably null Het
Trpa1 T C 1: 14,951,918 (GRCm39) E927G probably benign Het
Tyk2 A T 9: 21,026,776 (GRCm39) D637E probably benign Het
Vmn1r200 T C 13: 22,580,009 (GRCm39) F271L probably benign Het
Vmn1r231 T A 17: 21,110,894 (GRCm39) D7V probably damaging Het
Wwc2 G A 8: 48,321,512 (GRCm39) T534I unknown Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAGTGACCTCCCAGGAG -3'
(R):5'- GAAGATGGTTCTCGCACCTATGG -3'

Sequencing Primer
(F):5'- TCTCAAGCGGCAAGGGTG -3'
(R):5'- GTTCTCGCACCTATGGTTTTG -3'
Posted On 2019-12-20