Incidental Mutation 'R7854:Cep63'
ID607136
Institutional Source Beutler Lab
Gene Symbol Cep63
Ensembl Gene ENSMUSG00000032534
Gene Namecentrosomal protein 63
SynonymsD9Mgc48e, CD20R, D9Mgc41, ET2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R7854 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location102584588-102626534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102602998 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 269 (S269R)
Ref Sequence ENSEMBL: ENSMUSP00000091306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093791] [ENSMUST00000162655] [ENSMUST00000213636] [ENSMUST00000216281]
Predicted Effect probably damaging
Transcript: ENSMUST00000093791
AA Change: S269R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091306
Gene: ENSMUSG00000032534
AA Change: S269R

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:CEP63 76 338 8.1e-112 PFAM
coiled coil region 401 469 N/A INTRINSIC
coiled coil region 492 591 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
coiled coil region 730 749 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162655
AA Change: S211R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125621
Gene: ENSMUSG00000032534
AA Change: S211R

DomainStartEndE-ValueType
coiled coil region 72 220 N/A INTRINSIC
coiled coil region 243 283 N/A INTRINSIC
coiled coil region 343 411 N/A INTRINSIC
coiled coil region 434 484 N/A INTRINSIC
coiled coil region 510 529 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213636
AA Change: S120R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215253
Predicted Effect probably damaging
Transcript: ENSMUST00000216281
AA Change: S269R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the centrosome, the main microtubule-organizing center of the cell. The encoded protein associates with another centrosomal protein, CEP152, to regulate mother-centriole-dependent centriole duplication in dividing cells. Disruption of a similar gene in human has been associated with primary microcephaly (MCPH). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth defects, microcephaly, thin cerebral cortex, mitotic defects and cell death in neural progenitors, decreased oocyte number, small testis, and severely impaired spermatogenesis and meiotic recombination leading to male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,112,377 Y48F probably benign Het
Adgrv1 T A 13: 81,593,088 I86F probably damaging Het
Aes A G 10: 81,565,647 H183R probably damaging Het
Als2cl A G 9: 110,898,496 *953W probably null Het
Ap1g2 A G 14: 55,105,933 F66L probably damaging Het
Aqp12 T G 1: 93,006,454 C18G probably damaging Het
Atp9a T C 2: 168,648,603 I826V probably benign Het
C1ra A G 6: 124,517,741 Q321R probably benign Het
Calcoco1 T C 15: 102,719,556 I48V possibly damaging Het
Chchd7 T C 4: 3,943,422 V63A possibly damaging Het
Dennd5b T C 6: 149,068,466 D163G probably benign Het
Dpep2 T C 8: 105,989,528 D251G Het
Ercc6 T C 14: 32,566,292 L807P probably damaging Het
Fads6 A T 11: 115,297,396 D27E probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Glce A T 9: 62,070,491 I37N probably benign Het
Gps2 T C 11: 69,915,204 L128P probably damaging Het
Gramd3 A G 18: 56,478,854 T130A probably damaging Het
Hectd4 T A 5: 121,329,568 Y2527N probably benign Het
Itpr1 A G 6: 108,387,369 D820G probably damaging Het
Itsn2 T C 12: 4,701,276 Y1289H probably damaging Het
Kcnh6 A T 11: 106,017,346 I263F probably damaging Het
Kcns2 A T 15: 34,839,771 M427L probably benign Het
Mptx1 A T 1: 174,332,400 M91L probably benign Het
Mtx2 A G 2: 74,868,887 Y128C probably damaging Het
Myh9 A T 15: 77,791,753 D244E probably benign Het
Ndufs2 T C 1: 171,239,369 D140G probably damaging Het
Obscn T C 11: 59,090,712 T1827A probably benign Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr356 A G 2: 36,938,024 R302G probably benign Het
Olfr568 C T 7: 102,877,785 R222* probably null Het
Parp4 A G 14: 56,659,348 E1943G unknown Het
Pex19 T G 1: 172,126,850 probably null Het
Prss53 T C 7: 127,888,945 N166S probably benign Het
Prx T A 7: 27,516,641 V328E probably damaging Het
Pstpip2 C T 18: 77,874,304 T258I probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Ros1 T C 10: 52,128,467 Y1019C probably damaging Het
Rptor T C 11: 119,857,953 M787T probably benign Het
Rsf1 GGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCAGCGGCAGCGGCGGCGGC 7: 97,579,924 probably benign Het
Spef2 T A 15: 9,596,644 R1440W possibly damaging Het
Spta1 T A 1: 174,218,830 probably null Het
Sptbn4 T C 7: 27,362,410 I2335V probably benign Het
Taar1 A G 10: 23,920,782 D126G probably benign Het
Tdrd9 A G 12: 112,046,961 T1210A probably benign Het
Tpcn1 A G 5: 120,549,588 F364L probably damaging Het
Trav2 A T 14: 52,567,781 K20* probably null Het
Trpa1 T C 1: 14,881,694 E927G probably benign Het
Tyk2 A T 9: 21,115,480 D637E probably benign Het
Vmn1r200 T C 13: 22,395,839 F271L probably benign Het
Vmn1r231 T A 17: 20,890,632 D7V probably damaging Het
Wwc2 G A 8: 47,868,477 T534I unknown Het
Other mutations in Cep63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Cep63 APN 9 102590458 missense possibly damaging 0.88
IGL02378:Cep63 APN 9 102596115 splice site probably benign
IGL02707:Cep63 APN 9 102586981 missense probably damaging 1.00
IGL03273:Cep63 APN 9 102602467 missense probably benign 0.13
R0355:Cep63 UTSW 9 102623560 missense probably benign
R0847:Cep63 UTSW 9 102588758 missense probably benign 0.12
R1276:Cep63 UTSW 9 102588900 missense possibly damaging 0.77
R1398:Cep63 UTSW 9 102603086 splice site probably benign
R1654:Cep63 UTSW 9 102586913 missense possibly damaging 0.87
R1730:Cep63 UTSW 9 102618867 missense possibly damaging 0.93
R1982:Cep63 UTSW 9 102602880 missense probably damaging 0.99
R2359:Cep63 UTSW 9 102594564 missense possibly damaging 0.95
R2890:Cep63 UTSW 9 102618827 missense probably damaging 0.99
R3082:Cep63 UTSW 9 102602497 missense probably benign 0.00
R4725:Cep63 UTSW 9 102590556 intron probably benign
R4761:Cep63 UTSW 9 102587041 intron probably benign
R5200:Cep63 UTSW 9 102598188 missense probably benign 0.22
R5538:Cep63 UTSW 9 102588793 nonsense probably null
R6463:Cep63 UTSW 9 102596155 missense probably benign
R6887:Cep63 UTSW 9 102625927 intron probably benign
R7937:Cep63 UTSW 9 102602998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGTCCTAGGGCATGCATATACC -3'
(R):5'- TGTCCAAAACCTGCTGATAGCC -3'

Sequencing Primer
(F):5'- TAGGGCATGCATATACCTCCCTAAG -3'
(R):5'- CCAGCCTTCCTAGGAGTGAATC -3'
Posted On2019-12-20