Incidental Mutation 'R7855:Il1rl2'
ID607165
Institutional Source Beutler Lab
Gene Symbol Il1rl2
Ensembl Gene ENSMUSG00000070942
Gene Nameinterleukin 1 receptor-like 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7855 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location40324610-40367562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40343119 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 197 (Y197S)
Ref Sequence ENSEMBL: ENSMUSP00000092630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095020] [ENSMUST00000194296]
Predicted Effect probably damaging
Transcript: ENSMUST00000095020
AA Change: Y197S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092630
Gene: ENSMUSG00000070942
AA Change: Y197S

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
IG 29 115 7.52e-8 SMART
IG 134 219 1.94e-1 SMART
IG_like 237 333 2.39e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
TIR 385 542 5.05e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194296
AA Change: Y197S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142248
Gene: ENSMUSG00000070942
AA Change: Y197S

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
IG 29 115 7.52e-8 SMART
IG 134 219 1.94e-1 SMART
IG_like 237 333 2.39e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
TIR 385 542 5.05e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 receptor family. An experiment with transient gene expression demonstrated that this receptor was incapable of binding to interleukin 1 alpha and interleukin 1 beta with high affinity. This gene and four other interleukin 1 receptor family genes, including interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2), interleukin 1 receptor-like 1 (IL1RL1), and interleukin 18 receptor 1 (IL18R1), form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are viable and overtly normal and have normal skin in an unchallenged context. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Il1rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Il1rl2 APN 1 40356814 splice site probably null
IGL02490:Il1rl2 APN 1 40356812 splice site probably benign
IGL03201:Il1rl2 APN 1 40343040 missense possibly damaging 0.95
IGL03269:Il1rl2 APN 1 40365312 missense probably damaging 1.00
R0088:Il1rl2 UTSW 1 40365053 missense possibly damaging 0.87
R0418:Il1rl2 UTSW 1 40326502 missense unknown
R0504:Il1rl2 UTSW 1 40329056 missense probably benign 0.00
R1629:Il1rl2 UTSW 1 40356860 missense probably benign 0.02
R1679:Il1rl2 UTSW 1 40343160 missense probably benign 0.36
R1680:Il1rl2 UTSW 1 40351793 missense possibly damaging 0.61
R1892:Il1rl2 UTSW 1 40327534 missense probably damaging 1.00
R1938:Il1rl2 UTSW 1 40363324 missense probably damaging 1.00
R2020:Il1rl2 UTSW 1 40365214 missense probably damaging 0.98
R4193:Il1rl2 UTSW 1 40365048 missense probably damaging 1.00
R4364:Il1rl2 UTSW 1 40351791 missense probably benign
R4365:Il1rl2 UTSW 1 40351791 missense probably benign
R4657:Il1rl2 UTSW 1 40327310 intron probably benign
R4840:Il1rl2 UTSW 1 40327387 missense possibly damaging 0.84
R4890:Il1rl2 UTSW 1 40327310 intron probably benign
R5051:Il1rl2 UTSW 1 40343094 missense probably benign 0.03
R5239:Il1rl2 UTSW 1 40365095 missense probably benign 0.03
R5447:Il1rl2 UTSW 1 40329156 missense probably damaging 1.00
R6013:Il1rl2 UTSW 1 40351857 missense possibly damaging 0.82
R6162:Il1rl2 UTSW 1 40351878 missense probably damaging 1.00
R6244:Il1rl2 UTSW 1 40327566 missense possibly damaging 0.78
R6798:Il1rl2 UTSW 1 40365240 missense probably damaging 1.00
R7667:Il1rl2 UTSW 1 40365253 missense probably damaging 0.99
R7857:Il1rl2 UTSW 1 40327482 missense probably benign 0.44
R7938:Il1rl2 UTSW 1 40343119 missense probably damaging 1.00
R7940:Il1rl2 UTSW 1 40327482 missense probably benign 0.44
Z1177:Il1rl2 UTSW 1 40327310 intron probably benign
Predicted Primers PCR Primer
(F):5'- GATATAGACACATTTCCGCACAG -3'
(R):5'- CCTGATCTATCACCAGCATGG -3'

Sequencing Primer
(F):5'- CCGCACAGTTCATAGGTTAATGCTG -3'
(R):5'- GGGGGCTCTGTACAATCAATATCC -3'
Posted On2019-12-20