Incidental Mutation 'R7855:Elf3'
ID 607168
Institutional Source Beutler Lab
Gene Symbol Elf3
Ensembl Gene ENSMUSG00000003051
Gene Name E74-like factor 3
Synonyms ESX, jen, ESE-1
MMRRC Submission 045908-MU
Accession Numbers

Ncbi RefSeq: NM_001163131.1, NM_007921.3; MGI:1101781
Essential gene? Probably essential (E-score: 0.891) question?
Stock # R7855 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 135253575-135258568 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 135254352 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 364 (R364W)
Ref Sequence ENSEMBL: ENSMUSP00000003135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]
AlphaFold Q3UPW2
PDB Structure Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-beta receptor promoter DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003135
AA Change: R364W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: R364W

DomainStartEndE-ValueType
SAM_PNT 67 151 6.32e-30 SMART
low complexity region 230 241 N/A INTRINSIC
AT_hook 264 276 1.29e0 SMART
ETS 292 379 6.11e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185752
AA Change: R344W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: R344W

DomainStartEndE-ValueType
SAM_PNT 47 131 1.36e-29 SMART
low complexity region 210 221 N/A INTRINSIC
AT_hook 244 256 1.29e0 SMART
ETS 272 359 6.11e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 2662485
Lethality: D11-D21
PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Elf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Elf3 APN 1 135257707 missense possibly damaging 0.94
IGL02470:Elf3 APN 1 135255012 missense probably damaging 1.00
IGL03018:Elf3 APN 1 135256065 missense possibly damaging 0.62
IGL03252:Elf3 APN 1 135254953 missense probably damaging 1.00
P0026:Elf3 UTSW 1 135255973 critical splice donor site probably null
R0087:Elf3 UTSW 1 135257137 missense probably damaging 1.00
R1842:Elf3 UTSW 1 135256793 missense possibly damaging 0.65
R1897:Elf3 UTSW 1 135257137 missense probably damaging 1.00
R2081:Elf3 UTSW 1 135257076 missense probably benign 0.12
R4049:Elf3 UTSW 1 135254277 missense probably benign 0.21
R4467:Elf3 UTSW 1 135256844 missense probably damaging 1.00
R4630:Elf3 UTSW 1 135256740 intron probably benign
R4715:Elf3 UTSW 1 135257752 missense probably damaging 1.00
R4923:Elf3 UTSW 1 135256735 intron probably benign
R5226:Elf3 UTSW 1 135257239 missense probably benign 0.07
R5422:Elf3 UTSW 1 135255040 missense probably damaging 0.98
R5706:Elf3 UTSW 1 135256482 missense probably benign 0.01
R7115:Elf3 UTSW 1 135257118 missense probably damaging 1.00
R7644:Elf3 UTSW 1 135256506 missense possibly damaging 0.89
R7940:Elf3 UTSW 1 135257128 missense probably damaging 1.00
R8315:Elf3 UTSW 1 135256576 missense probably benign 0.00
R8723:Elf3 UTSW 1 135257647 missense possibly damaging 0.95
R8724:Elf3 UTSW 1 135254360 missense probably damaging 1.00
R8906:Elf3 UTSW 1 135254940 missense probably damaging 1.00
R8960:Elf3 UTSW 1 135255075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCTACAGCAACACAGGG -3'
(R):5'- CAGGTGCTCTGGCCATAATTAC -3'

Sequencing Primer
(F):5'- ACATCCATGTTAAGGGGGCCATC -3'
(R):5'- GGTGCTCTGGCCATAATTACAGATC -3'
Posted On 2019-12-20