Incidental Mutation 'R7855:Il2ra'
ID607169
Institutional Source Beutler Lab
Gene Symbol Il2ra
Ensembl Gene ENSMUSG00000026770
Gene Nameinterleukin 2 receptor, alpha chain
SynonymsCD25, Ly-43, Il2r, IL-2R alpha chain
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7855 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location11642807-11693193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11680336 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 161 (I161T)
Ref Sequence ENSEMBL: ENSMUSP00000028111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028111
AA Change: I161T

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028111
Gene: ENSMUSG00000026770
AA Change: I161T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CCP 24 77 5e-2 SMART
CCP 121 180 1.2e-4 SMART
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The interleukin 2 (IL2) receptor alpha (IL2RA) and beta (IL2RB) chains, together with the common gamma chain (IL2RG), constitute the high-affinity IL2 receptor. Homodimeric alpha chains (IL2RA) result in low-affinity receptor, while homodimeric beta (IL2RB) chains produce a medium-affinity receptor. Normally an integral-membrane protein, soluble IL2RA has been isolated and determined to result from extracellular proteolyisis. Alternately-spliced IL2RA mRNAs have been isolated, but the significance of each is presently unknown. Mutations in this gene are associated with interleukin 2 receptor alpha deficiency.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit massive proliferation of polyclonal T and B cells as adults and develop autoimmune disorders including inflammatory bowel disease and hemolytic anemia with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Il2ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Il2ra APN 2 11683099 missense probably benign 0.12
IGL01393:Il2ra APN 2 11683054 missense probably damaging 0.99
IGL01594:Il2ra APN 2 11680396 missense possibly damaging 0.85
IGL02519:Il2ra APN 2 11683090 missense possibly damaging 0.91
R0206:Il2ra UTSW 2 11682017 splice site probably benign
R0208:Il2ra UTSW 2 11682017 splice site probably benign
R0635:Il2ra UTSW 2 11680366 missense probably benign 0.38
R0666:Il2ra UTSW 2 11643073 splice site probably benign
R4732:Il2ra UTSW 2 11676920 missense probably benign
R4733:Il2ra UTSW 2 11676920 missense probably benign
R4959:Il2ra UTSW 2 11676853 missense possibly damaging 0.91
R5006:Il2ra UTSW 2 11674346 missense possibly damaging 0.83
R5531:Il2ra UTSW 2 11676892 missense possibly damaging 0.91
R5899:Il2ra UTSW 2 11684437 missense probably benign
R6145:Il2ra UTSW 2 11680246 missense probably damaging 1.00
R6184:Il2ra UTSW 2 11647979 intron probably benign
R6449:Il2ra UTSW 2 11680362 missense probably benign
R6472:Il2ra UTSW 2 11681969 missense possibly damaging 0.91
R7300:Il2ra UTSW 2 11676910 missense not run
R7371:Il2ra UTSW 2 11643020 missense probably benign 0.07
R7938:Il2ra UTSW 2 11680336 missense possibly damaging 0.65
Z1176:Il2ra UTSW 2 11681931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATTTGCTGTGTCTTCC -3'
(R):5'- GGAACCTCAGCATTTCGAGTG -3'

Sequencing Primer
(F):5'- GCTGTGTCTTCCCAAACTTG -3'
(R):5'- CTGTGTTTTAAAAGGTGAGACCCAG -3'
Posted On2019-12-20