Mutagenetix > Incidental Mutation

Incidental Mutation 'R7855:Kcnh7'

607170

Institutional Source

Beutler Lab

Gene Symbol

Kcnh7

Ensembl Gene

ENSMUSG00000059742

Gene Name

potassium voltage-gated channel, subfamily H (eag-related), member 7

Synonyms

Kv11.3, 9330137I11Rik, erg3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R7855 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62693414-63184287 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 62837194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 334 (Q334*)

Ref Sequence

ENSEMBL: ENSMUSP00000074563 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075052] [ENSMUST00000112452] [ENSMUST00000112454]

AlphaFold

Q9ER47

Predicted Effect

probably null
Transcript: ENSMUST00000075052
AA Change: Q334*

SMART Domains

Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: Q334*

Domain	Start	End	E-Value	Type
PAS	20	87	8.97e0	SMART
PAC	93	135	3.48e-1	SMART
Pfam:Ion_trans	407	674	4.9e-39	PFAM
Pfam:Ion_trans_2	588	668	3.2e-13	PFAM
cNMP	745	863	1.5e-23	SMART
low complexity region	921	940	N/A	INTRINSIC
coiled coil region	1022	1058	N/A	INTRINSIC
low complexity region	1114	1127	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000112452
AA Change: Q327*

SMART Domains

Protein: ENSMUSP00000108071
Gene: ENSMUSG00000059742
AA Change: Q327*

Domain	Start	End	E-Value	Type
PAS	20	87	8.97e0	SMART
PAC	93	135	3.48e-1	SMART
Blast:MYSc	309	426	4e-24	BLAST
low complexity region	446	461	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000112454
AA Change: Q334*

SMART Domains

Protein: ENSMUSP00000108073
Gene: ENSMUSG00000059742
AA Change: Q334*

Domain	Start	End	E-Value	Type
PAS	20	87	8.97e0	SMART
PAC	93	135	3.48e-1	SMART
Blast:MYSc	316	433	3e-24	BLAST
low complexity region	453	468	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	A	19: 7,422,256	I456N	probably damaging	Het
Abca6	A	T	11: 110,191,628	V1173D	probably benign	Het
Ace	A	T	11: 105,972,379	M327L	probably benign	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicdl2	C	T	17: 23,666,017	Q231*	probably null	Het
Brms1l	A	T	12: 55,866,053	D277V	possibly damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Col6a3	G	T	1: 90,810,621	P1059T	possibly damaging	Het
Coro1c	A	T	5: 113,848,597	M262K	probably benign	Het
Cpxm2	G	T	7: 132,057,695	P481Q	possibly damaging	Het
Dnah12	G	T	14: 26,829,329	V2543F	probably benign	Het
Dock2	A	C	11: 34,273,698	D1145E	probably damaging	Het
Elf3	G	A	1: 135,254,352	R364W	probably damaging	Het
Eln	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	5: 134,711,081		probably benign	Het
Epha3	A	G	16: 63,773,560	I55T	probably damaging	Het
Fam69c	G	A	18: 84,730,046		probably benign	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Gm10436	A	T	12: 88,176,083	I450N	probably benign	Het
Gm11568	A	T	11: 99,858,184	T72S	unknown	Het
Gm21994	C	T	2: 150,255,146	R121Q	probably benign	Het
Gm5415	A	C	1: 32,546,033	I265M	probably damaging	Het
Igkv3-1	C	T	6: 70,704,069	A84V	probably benign	Het
Il1rl2	A	C	1: 40,343,119	Y197S	probably damaging	Het
Il2ra	T	C	2: 11,680,336	I161T	possibly damaging	Het
Itgb8	C	T	12: 119,166,772	R667H	probably benign	Het
Lctl	A	C	9: 64,133,216	R480S	possibly damaging	Het
Lrba	T	G	3: 86,315,430	I617S	possibly damaging	Het
Marf1	G	T	16: 14,114,201	H1651N	probably benign	Het
Mitf	T	A	6: 97,993,196	Y142N	probably damaging	Het
Olfr569	A	G	7: 102,887,628	V175A	probably benign	Het
Olfr620	T	A	7: 103,611,772	I194F	possibly damaging	Het
Pecam1	A	G	11: 106,671,750	V708A	probably benign	Het
Pinlyp	C	T	7: 24,542,440		probably null	Het
Polh	G	A	17: 46,175,248	R382W	probably damaging	Het
Prdm10	A	G	9: 31,327,474	I221V	probably benign	Het
Pskh1	G	T	8: 105,913,090	R134L	probably benign	Het
Ptpre	A	G	7: 135,651,995	N6D	probably benign	Het
Rasgrp4	C	T	7: 29,150,610	P58L	unknown	Het
Rhbdf2	G	T	11: 116,602,240	C393*	probably null	Het
Rlf	T	C	4: 121,182,691	I174M	possibly damaging	Het
Ryr2	T	A	13: 11,706,623	R2641*	probably null	Het
Simc1	A	G	13: 54,524,832	H331R	probably benign	Het
Skp2	A	G	15: 9,122,241	S256P	probably benign	Het
Smarcd2	T	C	11: 106,267,566	R10G	probably benign	Het
Spef2	A	G	15: 9,687,895	L480P	possibly damaging	Het
Tenm4	A	G	7: 96,873,874	H1541R	probably damaging	Het
Top1	T	A	2: 160,714,088	L489Q	probably damaging	Het
Ttll13	C	T	7: 80,254,097	H258Y	probably damaging	Het
Unc80	A	G	1: 66,483,349	R237G	possibly damaging	Het
Vmn1r55	A	G	7: 5,146,624	F267L	probably benign	Het
Vmn2r96	T	A	17: 18,597,868	M761K	possibly damaging	Het
Vps33a	G	A	5: 123,570,979	H58Y	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp467	T	C	6: 48,439,181	Q179R	probably damaging	Het
Zfp729a	A	T	13: 67,619,948	S721T	possibly damaging	Het

Other mutations in Kcnh7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Kcnh7	APN	2	62764691	missense	probably benign	0.01
IGL00693:Kcnh7	APN	2	62734254	missense	probably benign	0.06
IGL00776:Kcnh7	APN	2	62850376	missense	probably benign	0.00
IGL00956:Kcnh7	APN	2	62777639	missense	probably damaging	1.00
IGL01651:Kcnh7	APN	2	62734284	missense	possibly damaging	0.47
IGL01780:Kcnh7	APN	2	62837163	missense	probably benign	0.17
IGL01859:Kcnh7	APN	2	62721788	missense	probably benign	0.00
IGL02213:Kcnh7	APN	2	62739362	missense	probably damaging	1.00
IGL02302:Kcnh7	APN	2	62706058	missense	probably damaging	1.00
IGL02526:Kcnh7	APN	2	62850437	missense	possibly damaging	0.46
IGL02850:Kcnh7	APN	2	62787685	nonsense	probably null
IGL02989:Kcnh7	APN	2	62721925	missense	probably benign
IGL02990:Kcnh7	APN	2	62705986	missense	probably benign	0.11
G1citation:Kcnh7	UTSW	2	62787904	missense	probably damaging	1.00
LCD18:Kcnh7	UTSW	2	63049799	intron	probably benign
R0129:Kcnh7	UTSW	2	62716159	missense	probably benign	0.00
R0622:Kcnh7	UTSW	2	62837289	splice site	probably null
R0638:Kcnh7	UTSW	2	62777510	missense	probably benign	0.13
R1006:Kcnh7	UTSW	2	62716183	missense	probably benign	0.00
R1200:Kcnh7	UTSW	2	62777395	missense	probably damaging	1.00
R1330:Kcnh7	UTSW	2	62777411	missense	possibly damaging	0.56
R1614:Kcnh7	UTSW	2	62850604	missense	probably benign	0.03
R1782:Kcnh7	UTSW	2	62736169	missense	probably damaging	1.00
R1861:Kcnh7	UTSW	2	62777392	missense	probably damaging	0.97
R1862:Kcnh7	UTSW	2	62787754	missense	possibly damaging	0.46
R2197:Kcnh7	UTSW	2	62777606	missense	probably damaging	1.00
R2510:Kcnh7	UTSW	2	62721917	missense	probably benign
R2988:Kcnh7	UTSW	2	62721828	missense	probably benign	0.20
R3024:Kcnh7	UTSW	2	62764663	missense	probably damaging	1.00
R3433:Kcnh7	UTSW	2	62721917	missense	probably benign
R4415:Kcnh7	UTSW	2	62706073	missense	probably damaging	1.00
R4540:Kcnh7	UTSW	2	62739186	missense	probably damaging	1.00
R4570:Kcnh7	UTSW	2	62837095	missense	possibly damaging	0.91
R4827:Kcnh7	UTSW	2	62716220	missense	probably benign
R4990:Kcnh7	UTSW	2	62734288	missense	probably benign	0.00
R5172:Kcnh7	UTSW	2	62739164	missense	possibly damaging	0.88
R5822:Kcnh7	UTSW	2	62716238	missense	probably benign
R5996:Kcnh7	UTSW	2	63184097	start gained	probably benign
R6142:Kcnh7	UTSW	2	62739360	missense	possibly damaging	0.95
R6226:Kcnh7	UTSW	2	62777559	missense	probably damaging	1.00
R6244:Kcnh7	UTSW	2	63182226	missense	probably damaging	1.00
R6304:Kcnh7	UTSW	2	62764616	nonsense	probably null
R6400:Kcnh7	UTSW	2	62739344	missense	probably damaging	1.00
R6430:Kcnh7	UTSW	2	62850532	missense	probably benign	0.04
R6483:Kcnh7	UTSW	2	62845774	missense	probably benign	0.06
R6614:Kcnh7	UTSW	2	62777596	missense	probably damaging	1.00
R6753:Kcnh7	UTSW	2	62850377	missense	probably benign
R6822:Kcnh7	UTSW	2	62787904	missense	probably damaging	1.00
R6863:Kcnh7	UTSW	2	62787685	missense	possibly damaging	0.83
R7104:Kcnh7	UTSW	2	62787687	missense	possibly damaging	0.82
R7116:Kcnh7	UTSW	2	62877270	missense	probably benign	0.02
R7263:Kcnh7	UTSW	2	62735970	splice site	probably null
R7657:Kcnh7	UTSW	2	62736035	missense	probably damaging	1.00
R7968:Kcnh7	UTSW	2	62736100	missense	probably damaging	1.00
R8183:Kcnh7	UTSW	2	62702977	missense	probably damaging	0.99
R8343:Kcnh7	UTSW	2	62850535	missense	probably benign	0.01
R8405:Kcnh7	UTSW	2	62703102	missense	probably benign	0.04
R8411:Kcnh7	UTSW	2	62764608	missense	probably damaging	1.00
R8493:Kcnh7	UTSW	2	62850659	missense	probably benign	0.31
R8744:Kcnh7	UTSW	2	63182089	missense	possibly damaging	0.93
R8988:Kcnh7	UTSW	2	62721865	missense
R9082:Kcnh7	UTSW	2	62777534	missense	probably damaging	1.00
R9206:Kcnh7	UTSW	2	62777603	missense	probably damaging	1.00
R9272:Kcnh7	UTSW	2	62787753	missense	probably damaging	0.99
R9382:Kcnh7	UTSW	2	62837268	missense	probably benign	0.01
R9674:Kcnh7	UTSW	2	62764716	missense	probably damaging	1.00
R9771:Kcnh7	UTSW	2	62739375	missense	probably damaging	1.00
X0011:Kcnh7	UTSW	2	62764723	missense	probably damaging	0.99
Z1088:Kcnh7	UTSW	2	62736103	missense	probably damaging	1.00
Z1088:Kcnh7	UTSW	2	63184068	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTACAGAAAATAGCCTACCTC -3'
(R):5'- AAACTCACTGCACTGTGTCAC -3'

Sequencing Primer
(F):5'- GCCTACCTCACAGCTGAAATGTATAG -3'
(R):5'- GCACTGTGTCACTGGGATCATAC -3'

Posted On

2019-12-20