Mutagenetix > Incidental Mutation

Incidental Mutation 'R7855:Top1'

607172

Institutional Source

Beutler Lab

Gene Symbol

Top1

Ensembl Gene

ENSMUSG00000070544

Gene Name

topoisomerase (DNA) I

Synonyms

D130064I21Rik, Top-1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7855 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

160645888-160722764 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 160714088 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 489 (L489Q)

Ref Sequence

ENSEMBL: ENSMUSP00000105094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109468]

AlphaFold

Q04750

Predicted Effect

probably damaging
Transcript: ENSMUST00000109468
AA Change: L489Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105094
Gene: ENSMUSG00000070544
AA Change: L489Q

Domain	Start	End	E-Value	Type
low complexity region	20	95	N/A	INTRINSIC
low complexity region	150	211	N/A	INTRINSIC
Blast:TOPEUc	245	321	9e-19	BLAST
low complexity region	323	339	N/A	INTRINSIC
TOPEUc	362	739	4.43e-280	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous mutation resulted in early embryonic lethality at the 4 to 16 cell stage of development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	A	19: 7,422,256	I456N	probably damaging	Het
Abca6	A	T	11: 110,191,628	V1173D	probably benign	Het
Ace	A	T	11: 105,972,379	M327L	probably benign	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicdl2	C	T	17: 23,666,017	Q231*	probably null	Het
Brms1l	A	T	12: 55,866,053	D277V	possibly damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Col6a3	G	T	1: 90,810,621	P1059T	possibly damaging	Het
Coro1c	A	T	5: 113,848,597	M262K	probably benign	Het
Cpxm2	G	T	7: 132,057,695	P481Q	possibly damaging	Het
Dnah12	G	T	14: 26,829,329	V2543F	probably benign	Het
Dock2	A	C	11: 34,273,698	D1145E	probably damaging	Het
Elf3	G	A	1: 135,254,352	R364W	probably damaging	Het
Eln	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	5: 134,711,081		probably benign	Het
Epha3	A	G	16: 63,773,560	I55T	probably damaging	Het
Fam69c	G	A	18: 84,730,046		probably benign	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Gm10436	A	T	12: 88,176,083	I450N	probably benign	Het
Gm11568	A	T	11: 99,858,184	T72S	unknown	Het
Gm21994	C	T	2: 150,255,146	R121Q	probably benign	Het
Gm5415	A	C	1: 32,546,033	I265M	probably damaging	Het
Igkv3-1	C	T	6: 70,704,069	A84V	probably benign	Het
Il1rl2	A	C	1: 40,343,119	Y197S	probably damaging	Het
Il2ra	T	C	2: 11,680,336	I161T	possibly damaging	Het
Itgb8	C	T	12: 119,166,772	R667H	probably benign	Het
Kcnh7	G	A	2: 62,837,194	Q334*	probably null	Het
Lctl	A	C	9: 64,133,216	R480S	possibly damaging	Het
Lrba	T	G	3: 86,315,430	I617S	possibly damaging	Het
Marf1	G	T	16: 14,114,201	H1651N	probably benign	Het
Mitf	T	A	6: 97,993,196	Y142N	probably damaging	Het
Olfr569	A	G	7: 102,887,628	V175A	probably benign	Het
Olfr620	T	A	7: 103,611,772	I194F	possibly damaging	Het
Pecam1	A	G	11: 106,671,750	V708A	probably benign	Het
Pinlyp	C	T	7: 24,542,440		probably null	Het
Polh	G	A	17: 46,175,248	R382W	probably damaging	Het
Prdm10	A	G	9: 31,327,474	I221V	probably benign	Het
Pskh1	G	T	8: 105,913,090	R134L	probably benign	Het
Ptpre	A	G	7: 135,651,995	N6D	probably benign	Het
Rasgrp4	C	T	7: 29,150,610	P58L	unknown	Het
Rhbdf2	G	T	11: 116,602,240	C393*	probably null	Het
Rlf	T	C	4: 121,182,691	I174M	possibly damaging	Het
Ryr2	T	A	13: 11,706,623	R2641*	probably null	Het
Simc1	A	G	13: 54,524,832	H331R	probably benign	Het
Skp2	A	G	15: 9,122,241	S256P	probably benign	Het
Smarcd2	T	C	11: 106,267,566	R10G	probably benign	Het
Spef2	A	G	15: 9,687,895	L480P	possibly damaging	Het
Tenm4	A	G	7: 96,873,874	H1541R	probably damaging	Het
Ttll13	C	T	7: 80,254,097	H258Y	probably damaging	Het
Unc80	A	G	1: 66,483,349	R237G	possibly damaging	Het
Vmn1r55	A	G	7: 5,146,624	F267L	probably benign	Het
Vmn2r96	T	A	17: 18,597,868	M761K	possibly damaging	Het
Vps33a	G	A	5: 123,570,979	H58Y	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp467	T	C	6: 48,439,181	Q179R	probably damaging	Het
Zfp729a	A	T	13: 67,619,948	S721T	possibly damaging	Het

Other mutations in Top1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02168:Top1	APN	2	160704973	splice site	probably null
IGL03083:Top1	APN	2	160703578	missense	probably damaging	0.97
IGL03242:Top1	APN	2	160715733	missense	probably damaging	1.00
IGL03369:Top1	APN	2	160693727	missense	unknown
Mainspring	UTSW	2	160714238	missense	probably damaging	0.98
taut	UTSW	2	160721001	missense	probably damaging	0.99
unwind	UTSW	2	160704819	missense	probably damaging	1.00
R0022:Top1	UTSW	2	160702799	missense	possibly damaging	0.62
R0449:Top1	UTSW	2	160712708	nonsense	probably null
R0501:Top1	UTSW	2	160714159	missense	probably damaging	1.00
R0564:Top1	UTSW	2	160714265	missense	probably damaging	0.98
R0946:Top1	UTSW	2	160712668	nonsense	probably null
R0972:Top1	UTSW	2	160721025	missense	probably damaging	1.00
R0976:Top1	UTSW	2	160717423	missense	possibly damaging	0.86
R1534:Top1	UTSW	2	160714232	missense	probably damaging	1.00
R1608:Top1	UTSW	2	160703595	missense	probably benign	0.01
R1655:Top1	UTSW	2	160703696	critical splice donor site	probably null
R1818:Top1	UTSW	2	160715723	missense	probably damaging	1.00
R1937:Top1	UTSW	2	160670122	missense	unknown
R2055:Top1	UTSW	2	160702828	splice site	probably benign
R2104:Top1	UTSW	2	160704819	missense	probably damaging	1.00
R3705:Top1	UTSW	2	160702824	critical splice donor site	probably null
R3769:Top1	UTSW	2	160721522	missense	probably damaging	1.00
R3770:Top1	UTSW	2	160721522	missense	probably damaging	1.00
R3801:Top1	UTSW	2	160702768	missense	probably damaging	1.00
R3804:Top1	UTSW	2	160702768	missense	probably damaging	1.00
R3928:Top1	UTSW	2	160687749	splice site	probably benign
R4598:Top1	UTSW	2	160720965	missense	possibly damaging	0.89
R4651:Top1	UTSW	2	160712717	missense	probably damaging	1.00
R4652:Top1	UTSW	2	160712717	missense	probably damaging	1.00
R4742:Top1	UTSW	2	160703570	critical splice acceptor site	probably null
R5523:Top1	UTSW	2	160702775	nonsense	probably null
R6292:Top1	UTSW	2	160698141	missense	probably benign	0.19
R6724:Top1	UTSW	2	160712696	missense	probably damaging	1.00
R7354:Top1	UTSW	2	160704958	missense	probably damaging	1.00
R7461:Top1	UTSW	2	160712842	splice site	probably null
R7843:Top1	UTSW	2	160714256	missense	possibly damaging	0.90
R8100:Top1	UTSW	2	160698235	nonsense	probably null
R8302:Top1	UTSW	2	160703576	missense	probably damaging	1.00
R8377:Top1	UTSW	2	160646089	start gained	probably benign
R8380:Top1	UTSW	2	160717395	missense	probably benign	0.00
R8381:Top1	UTSW	2	160703674	missense	probably null	0.77
R8392:Top1	UTSW	2	160717454	nonsense	probably null
R8713:Top1	UTSW	2	160717440	missense	probably damaging	0.98
R8773:Top1	UTSW	2	160714238	missense	probably damaging	0.98
R8844:Top1	UTSW	2	160721549	missense	probably damaging	1.00
R8949:Top1	UTSW	2	160705262	missense	possibly damaging	0.77
R8992:Top1	UTSW	2	160721001	missense	probably damaging	0.99
R9133:Top1	UTSW	2	160703671	nonsense	probably null
R9799:Top1	UTSW	2	160721486	missense	probably damaging	1.00
X0027:Top1	UTSW	2	160721518	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGAGAAACTTGGGTCTCTGGG -3'
(R):5'- TCGTTTCTCAACTGGGACTTTG -3'

Sequencing Primer
(F):5'- AAGTACACTGTAGCTGTCTTCAGACC -3'
(R):5'- CAACTGGGACTTTGTTATAGTATCTG -3'

Posted On

2019-12-20