Mutagenetix > Incidental Mutation

Incidental Mutation 'R7855:Lrba'

607173

Institutional Source

Beutler Lab

Gene Symbol

Lrba

Ensembl Gene

ENSMUSG00000028080

Gene Name

LPS-responsive beige-like anchor

Synonyms

Lba, D3Ertd775e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7855 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86224680-86782692 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 86315430 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 617 (I617S)

Ref Sequence

ENSEMBL: ENSMUSP00000103261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000212390]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107635
AA Change: I617S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: I617S

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	211	377	4.6e-13	PFAM
Pfam:DUF4704	446	717	2.5e-109	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2049	7e-88	PFAM
Pfam:PH_BEACH	2075	2172	9.1e-31	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART
WD40	2760	2798	1.79e-1	SMART
WD40	2801	2840	4.28e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192145
AA Change: I617S

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: I617S

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	7.4e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.5e-92	PFAM
Pfam:PH_BEACH	2068	2172	7.5e-32	PFAM
Beach	2203	2480	2.87e-207	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194759
AA Change: I617S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: I617S

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	8.1e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.6e-92	PFAM
Pfam:PH_BEACH	2068	2172	8.3e-32	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212390
AA Change: I617S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	A	19: 7,422,256	I456N	probably damaging	Het
Abca6	A	T	11: 110,191,628	V1173D	probably benign	Het
Ace	A	T	11: 105,972,379	M327L	probably benign	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicdl2	C	T	17: 23,666,017	Q231*	probably null	Het
Brms1l	A	T	12: 55,866,053	D277V	possibly damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Col6a3	G	T	1: 90,810,621	P1059T	possibly damaging	Het
Coro1c	A	T	5: 113,848,597	M262K	probably benign	Het
Cpxm2	G	T	7: 132,057,695	P481Q	possibly damaging	Het
Dnah12	G	T	14: 26,829,329	V2543F	probably benign	Het
Dock2	A	C	11: 34,273,698	D1145E	probably damaging	Het
Elf3	G	A	1: 135,254,352	R364W	probably damaging	Het
Eln	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	5: 134,711,081		probably benign	Het
Epha3	A	G	16: 63,773,560	I55T	probably damaging	Het
Fam69c	G	A	18: 84,730,046		probably benign	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Gm10436	A	T	12: 88,176,083	I450N	probably benign	Het
Gm11568	A	T	11: 99,858,184	T72S	unknown	Het
Gm21994	C	T	2: 150,255,146	R121Q	probably benign	Het
Gm5415	A	C	1: 32,546,033	I265M	probably damaging	Het
Igkv3-1	C	T	6: 70,704,069	A84V	probably benign	Het
Il1rl2	A	C	1: 40,343,119	Y197S	probably damaging	Het
Il2ra	T	C	2: 11,680,336	I161T	possibly damaging	Het
Itgb8	C	T	12: 119,166,772	R667H	probably benign	Het
Kcnh7	G	A	2: 62,837,194	Q334*	probably null	Het
Lctl	A	C	9: 64,133,216	R480S	possibly damaging	Het
Marf1	G	T	16: 14,114,201	H1651N	probably benign	Het
Mitf	T	A	6: 97,993,196	Y142N	probably damaging	Het
Olfr569	A	G	7: 102,887,628	V175A	probably benign	Het
Olfr620	T	A	7: 103,611,772	I194F	possibly damaging	Het
Pecam1	A	G	11: 106,671,750	V708A	probably benign	Het
Pinlyp	C	T	7: 24,542,440		probably null	Het
Polh	G	A	17: 46,175,248	R382W	probably damaging	Het
Prdm10	A	G	9: 31,327,474	I221V	probably benign	Het
Pskh1	G	T	8: 105,913,090	R134L	probably benign	Het
Ptpre	A	G	7: 135,651,995	N6D	probably benign	Het
Rasgrp4	C	T	7: 29,150,610	P58L	unknown	Het
Rhbdf2	G	T	11: 116,602,240	C393*	probably null	Het
Rlf	T	C	4: 121,182,691	I174M	possibly damaging	Het
Ryr2	T	A	13: 11,706,623	R2641*	probably null	Het
Simc1	A	G	13: 54,524,832	H331R	probably benign	Het
Skp2	A	G	15: 9,122,241	S256P	probably benign	Het
Smarcd2	T	C	11: 106,267,566	R10G	probably benign	Het
Spef2	A	G	15: 9,687,895	L480P	possibly damaging	Het
Tenm4	A	G	7: 96,873,874	H1541R	probably damaging	Het
Top1	T	A	2: 160,714,088	L489Q	probably damaging	Het
Ttll13	C	T	7: 80,254,097	H258Y	probably damaging	Het
Unc80	A	G	1: 66,483,349	R237G	possibly damaging	Het
Vmn1r55	A	G	7: 5,146,624	F267L	probably benign	Het
Vmn2r96	T	A	17: 18,597,868	M761K	possibly damaging	Het
Vps33a	G	A	5: 123,570,979	H58Y	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp467	T	C	6: 48,439,181	Q179R	probably damaging	Het
Zfp729a	A	T	13: 67,619,948	S721T	possibly damaging	Het

Other mutations in Lrba

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Lrba	APN	3	86359782	missense	probably benign	0.00
IGL00788:Lrba	APN	3	86327685	missense	probably damaging	0.97
IGL01139:Lrba	APN	3	86642662	missense	possibly damaging	0.88
IGL01302:Lrba	APN	3	86295400	missense	probably damaging	1.00
IGL01612:Lrba	APN	3	86776177	missense	possibly damaging	0.89
IGL01718:Lrba	APN	3	86351248	missense	probably damaging	1.00
IGL01719:Lrba	APN	3	86327596	splice site	probably benign
IGL01730:Lrba	APN	3	86741424	missense	possibly damaging	0.89
IGL01735:Lrba	APN	3	86327661	missense	probably benign	0.28
IGL01875:Lrba	APN	3	86310047	missense	probably damaging	1.00
IGL01884:Lrba	APN	3	86310412	missense	possibly damaging	0.86
IGL02264:Lrba	APN	3	86780262	missense	probably damaging	0.99
IGL02638:Lrba	APN	3	86325073	missense	probably damaging	0.97
IGL02647:Lrba	APN	3	86359731	missense	probably benign	0.00
IGL02664:Lrba	APN	3	86325731	missense	possibly damaging	0.84
IGL02728:Lrba	APN	3	86776049	missense	probably damaging	0.99
IGL02730:Lrba	APN	3	86328199	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86354206	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86445413	missense	probably damaging	0.99
IGL02948:Lrba	APN	3	86310384	splice site	probably null
IGL03090:Lrba	APN	3	86773141	missense	probably benign	0.01
molasses	UTSW	3	86354307	critical splice donor site	probably null
oscar	UTSW	3	86350304	nonsense	probably null
oscar2	UTSW	3	86664458	nonsense	probably null
P0023:Lrba	UTSW	3	86417935	missense	probably damaging	1.00
PIT4802001:Lrba	UTSW	3	86664494	nonsense	probably null
R0077:Lrba	UTSW	3	86542688	missense	probably damaging	0.99
R0189:Lrba	UTSW	3	86368509	missense	probably damaging	1.00
R0217:Lrba	UTSW	3	86642722	missense	probably damaging	1.00
R0349:Lrba	UTSW	3	86540005	missense	probably damaging	1.00
R0396:Lrba	UTSW	3	86295179	missense	probably damaging	1.00
R0417:Lrba	UTSW	3	86715654	missense	probably damaging	1.00
R0536:Lrba	UTSW	3	86715532	missense	probably damaging	1.00
R0712:Lrba	UTSW	3	86297990	nonsense	probably null
R0722:Lrba	UTSW	3	86605989	critical splice donor site	probably null
R0828:Lrba	UTSW	3	86608370	splice site	probably null
R0927:Lrba	UTSW	3	86780233	missense	probably damaging	1.00
R1120:Lrba	UTSW	3	86295192	missense	probably damaging	1.00
R1141:Lrba	UTSW	3	86619558	missense	probably damaging	1.00
R1276:Lrba	UTSW	3	86664526	missense	probably damaging	1.00
R1449:Lrba	UTSW	3	86354278	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1474:Lrba	UTSW	3	86780266	splice site	probably benign
R1558:Lrba	UTSW	3	86351315	missense	probably damaging	1.00
R1596:Lrba	UTSW	3	86350304	nonsense	probably null
R1652:Lrba	UTSW	3	86539938	missense	probably damaging	1.00
R1800:Lrba	UTSW	3	86351868	missense	probably benign	0.00
R1819:Lrba	UTSW	3	86542634	missense	possibly damaging	0.80
R1862:Lrba	UTSW	3	86773203	critical splice donor site	probably null
R1917:Lrba	UTSW	3	86664501	missense	probably damaging	1.00
R1965:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1966:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1969:Lrba	UTSW	3	86608389	missense	probably damaging	0.99
R2011:Lrba	UTSW	3	86310017	missense	probably damaging	0.99
R2179:Lrba	UTSW	3	86354281	missense	probably damaging	1.00
R2186:Lrba	UTSW	3	86304336	missense	probably damaging	1.00
R2281:Lrba	UTSW	3	86776103	missense	possibly damaging	0.46
R2359:Lrba	UTSW	3	86348750	missense	probably benign	0.01
R2412:Lrba	UTSW	3	86327700	missense	probably damaging	1.00
R2496:Lrba	UTSW	3	86532087	missense	probably damaging	1.00
R3153:Lrba	UTSW	3	86285219	missense	probably damaging	0.99
R3708:Lrba	UTSW	3	86285024	missense	possibly damaging	0.80
R3746:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3747:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3748:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3749:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3750:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3758:Lrba	UTSW	3	86776049	missense	probably damaging	0.99
R3975:Lrba	UTSW	3	86351255	missense	probably damaging	1.00
R4210:Lrba	UTSW	3	86360126	missense	probably damaging	1.00
R4258:Lrba	UTSW	3	86445349	missense	probably damaging	1.00
R4657:Lrba	UTSW	3	86737164	missense	probably damaging	1.00
R4713:Lrba	UTSW	3	86359868	missense	probably benign	0.13
R4716:Lrba	UTSW	3	86642714	missense	probably damaging	0.99
R4811:Lrba	UTSW	3	86776141	missense	probably damaging	1.00
R4827:Lrba	UTSW	3	86360150	missense	possibly damaging	0.85
R4840:Lrba	UTSW	3	86619509	critical splice acceptor site	probably null
R4920:Lrba	UTSW	3	86664458	nonsense	probably null
R4948:Lrba	UTSW	3	86285028	missense	probably damaging	1.00
R4970:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R4985:Lrba	UTSW	3	86327436	splice site	probably null
R4993:Lrba	UTSW	3	86360037	missense	probably damaging	1.00
R5107:Lrba	UTSW	3	86359779	missense	possibly damaging	0.47
R5112:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R5122:Lrba	UTSW	3	86349154	nonsense	probably null
R5155:Lrba	UTSW	3	86351300	missense	probably benign	0.25
R5194:Lrba	UTSW	3	86328219	missense	probably damaging	1.00
R5280:Lrba	UTSW	3	86325022	missense	possibly damaging	0.94
R5445:Lrba	UTSW	3	86368595	missense	probably benign
R5469:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5513:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5578:Lrba	UTSW	3	86757507	missense	probably benign	0.27
R5740:Lrba	UTSW	3	86328342	missense	probably damaging	1.00
R5868:Lrba	UTSW	3	86319604	missense	probably damaging	1.00
R6104:Lrba	UTSW	3	86353792	missense	probably damaging	1.00
R6166:Lrba	UTSW	3	86354307	critical splice donor site	probably null
R6279:Lrba	UTSW	3	86348864	missense	probably benign	0.26
R6330:Lrba	UTSW	3	86348357	missense	probably benign	0.07
R6367:Lrba	UTSW	3	86368562	missense	probably benign	0.42
R6571:Lrba	UTSW	3	86360060	missense	probably damaging	1.00
R6584:Lrba	UTSW	3	86664576	missense	probably damaging	1.00
R6698:Lrba	UTSW	3	86304425	missense	probably damaging	0.99
R6763:Lrba	UTSW	3	86354263	missense	probably damaging	1.00
R6834:Lrba	UTSW	3	86350286	missense	probably benign	0.00
R6951:Lrba	UTSW	3	86745873	missense	probably benign	0.01
R6969:Lrba	UTSW	3	86619590	missense	probably benign	0.21
R7045:Lrba	UTSW	3	86285091	missense	probably benign	0.03
R7133:Lrba	UTSW	3	86394931	splice site	probably null
R7182:Lrba	UTSW	3	86741458	frame shift	probably null
R7214:Lrba	UTSW	3	86328326	missense	probably damaging	1.00
R7224:Lrba	UTSW	3	86395246	missense	probably damaging	1.00
R7243:Lrba	UTSW	3	86751516	splice site	probably null
R7350:Lrba	UTSW	3	86351902	missense	probably damaging	0.96
R7380:Lrba	UTSW	3	86325074	missense	probably damaging	1.00
R7492:Lrba	UTSW	3	86664528	missense	probably damaging	1.00
R7651:Lrba	UTSW	3	86741466	nonsense	probably null
R7729:Lrba	UTSW	3	86318167	missense	probably damaging	1.00
R7754:Lrba	UTSW	3	86445397	missense	probably damaging	1.00
R7762:Lrba	UTSW	3	86532201	missense	probably damaging	0.99
R7867:Lrba	UTSW	3	86368589	missense	probably damaging	1.00
R7912:Lrba	UTSW	3	86715565	missense	probably damaging	1.00
R7995:Lrba	UTSW	3	86619551	missense	probably damaging	1.00
R8013:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8014:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8024:Lrba	UTSW	3	86295401	nonsense	probably null
R8027:Lrba	UTSW	3	86417912	missense	probably benign	0.05
R8090:Lrba	UTSW	3	86348489	missense	probably benign
R8111:Lrba	UTSW	3	86327705	missense	probably damaging	1.00
R8118:Lrba	UTSW	3	86354226	missense	probably benign
R8204:Lrba	UTSW	3	86315403	missense	possibly damaging	0.95
R8239:Lrba	UTSW	3	86542575	missense	probably damaging	1.00
R8509:Lrba	UTSW	3	86348176	missense	probably benign	0.04
R8532:Lrba	UTSW	3	86757483	missense	probably damaging	1.00
R8726:Lrba	UTSW	3	86353755	missense	probably benign
R8744:Lrba	UTSW	3	86304333	missense	probably benign	0.08
R8782:Lrba	UTSW	3	86642669	missense	probably benign	0.00
R8784:Lrba	UTSW	3	86375928	missense	probably damaging	1.00
R8922:Lrba	UTSW	3	86356666	missense	probably damaging	1.00
R8964:Lrba	UTSW	3	86351245	missense	probably benign	0.22
R8971:Lrba	UTSW	3	86615081	missense	probably benign	0.00
R9046:Lrba	UTSW	3	86395236	missense	possibly damaging	0.94
R9155:Lrba	UTSW	3	86295201	missense	probably damaging	1.00
R9236:Lrba	UTSW	3	86353759	missense	probably benign	0.05
R9266:Lrba	UTSW	3	86291467	missense	probably benign	0.08
R9297:Lrba	UTSW	3	86373566	missense	probably damaging	1.00
R9404:Lrba	UTSW	3	86297917	missense	probably damaging	0.99
R9617:Lrba	UTSW	3	86359862	missense	probably benign
R9640:Lrba	UTSW	3	86619568	nonsense	probably null
R9779:Lrba	UTSW	3	86325771	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86297899	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86325089	missense	possibly damaging	0.95
Z1176:Lrba	UTSW	3	86715538	missense	probably benign	0.31
Z1176:Lrba	UTSW	3	86751532	missense	possibly damaging	0.85
Z1177:Lrba	UTSW	3	86540049	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCTCAGCATCTTACTGTTTGG -3'
(R):5'- CGACAATAATACAAGGTTGGCAAC -3'

Sequencing Primer
(F):5'- AGATGGGTACCAATGAGC -3'
(R):5'- TGATACCACTTCGGTCCT -3'

Posted On

2019-12-20