Mutagenetix > Incidental Mutation

Incidental Mutation 'R7855:Rlf'

607174

Institutional Source

Beutler Lab

Gene Symbol

Rlf

Ensembl Gene

ENSMUSG00000049878

Gene Name

rearranged L-myc fusion sequence

Synonyms

MommeD8, 9230110M18Rik

MMRRC Submission

045908-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7855 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121145373-121215084 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121182691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 174 (I174M)

Ref Sequence

ENSEMBL: ENSMUSP00000050825 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056635] [ENSMUST00000168615]

AlphaFold

A2A7F4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056635
AA Change: I174M

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000050825
Gene: ENSMUSG00000049878
AA Change: I174M

Domain	Start	End	E-Value	Type
low complexity region	2	31	N/A	INTRINSIC
low complexity region	129	149	N/A	INTRINSIC
low complexity region	298	309	N/A	INTRINSIC
ZnF_C2H2	554	575	1.27e2	SMART
ZnF_C2H2	581	603	1.08e-1	SMART
ZnF_C2H2	667	692	5.42e-2	SMART
ZnF_C2H2	710	732	8.09e-1	SMART
ZnF_C2H2	738	762	3.99e0	SMART
ZnF_C2H2	767	791	3.16e-3	SMART
ZnF_C2H2	797	821	1.18e-2	SMART
low complexity region	885	909	N/A	INTRINSIC
ZnF_C2H2	949	974	2.57e-3	SMART
low complexity region	1055	1066	N/A	INTRINSIC
ZnF_C2H2	1122	1147	5.9e-3	SMART
ZnF_C2H2	1167	1190	4.17e-3	SMART
low complexity region	1259	1285	N/A	INTRINSIC
ZnF_C2H2	1303	1328	5.06e-2	SMART
ZnF_C2H2	1355	1380	6.57e-1	SMART
ZnF_C2H2	1400	1425	3.83e-2	SMART
ZnF_C2H2	1437	1462	8.81e-2	SMART
low complexity region	1488	1514	N/A	INTRINSIC
low complexity region	1521	1533	N/A	INTRINSIC
ZnF_C2H2	1556	1581	4.81e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168615
AA Change: I64M

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127068
Gene: ENSMUSG00000049878
AA Change: I64M

Domain	Start	End	E-Value	Type
low complexity region	22	39	N/A	INTRINSIC
low complexity region	188	199	N/A	INTRINSIC
ZnF_C2H2	444	465	1.27e2	SMART
ZnF_C2H2	471	493	1.08e-1	SMART
ZnF_C2H2	557	582	5.42e-2	SMART
ZnF_C2H2	600	622	8.09e-1	SMART
ZnF_C2H2	628	652	3.99e0	SMART
ZnF_C2H2	657	681	3.16e-3	SMART
ZnF_C2H2	687	711	1.18e-2	SMART
low complexity region	775	799	N/A	INTRINSIC
ZnF_C2H2	839	864	2.57e-3	SMART
low complexity region	945	956	N/A	INTRINSIC
ZnF_C2H2	1012	1037	5.9e-3	SMART
ZnF_C2H2	1057	1080	4.17e-3	SMART
low complexity region	1149	1175	N/A	INTRINSIC
ZnF_C2H2	1193	1218	5.06e-2	SMART
ZnF_C2H2	1245	1270	6.57e-1	SMART
ZnF_C2H2	1290	1315	3.83e-2	SMART
ZnF_C2H2	1327	1352	8.81e-2	SMART
low complexity region	1378	1404	N/A	INTRINSIC
low complexity region	1411	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1471	4.81e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a hypomorphic ENU-induced allele exhibit postnatal lethality. Only a few mice survive to weaning age exhibiting a decreased body size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	A	19: 7,422,256	I456N	probably damaging	Het
Abca6	A	T	11: 110,191,628	V1173D	probably benign	Het
Ace	A	T	11: 105,972,379	M327L	probably benign	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicdl2	C	T	17: 23,666,017	Q231*	probably null	Het
Brms1l	A	T	12: 55,866,053	D277V	possibly damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Col6a3	G	T	1: 90,810,621	P1059T	possibly damaging	Het
Coro1c	A	T	5: 113,848,597	M262K	probably benign	Het
Cpxm2	G	T	7: 132,057,695	P481Q	possibly damaging	Het
Dnah12	G	T	14: 26,829,329	V2543F	probably benign	Het
Dock2	A	C	11: 34,273,698	D1145E	probably damaging	Het
Elf3	G	A	1: 135,254,352	R364W	probably damaging	Het
Eln	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	5: 134,711,081		probably benign	Het
Epha3	A	G	16: 63,773,560	I55T	probably damaging	Het
Fam69c	G	A	18: 84,730,046		probably benign	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Gm10436	A	T	12: 88,176,083	I450N	probably benign	Het
Gm11568	A	T	11: 99,858,184	T72S	unknown	Het
Gm21994	C	T	2: 150,255,146	R121Q	probably benign	Het
Gm5415	A	C	1: 32,546,033	I265M	probably damaging	Het
Igkv3-1	C	T	6: 70,704,069	A84V	probably benign	Het
Il1rl2	A	C	1: 40,343,119	Y197S	probably damaging	Het
Il2ra	T	C	2: 11,680,336	I161T	possibly damaging	Het
Itgb8	C	T	12: 119,166,772	R667H	probably benign	Het
Kcnh7	G	A	2: 62,837,194	Q334*	probably null	Het
Lctl	A	C	9: 64,133,216	R480S	possibly damaging	Het
Lrba	T	G	3: 86,315,430	I617S	possibly damaging	Het
Marf1	G	T	16: 14,114,201	H1651N	probably benign	Het
Mitf	T	A	6: 97,993,196	Y142N	probably damaging	Het
Olfr569	A	G	7: 102,887,628	V175A	probably benign	Het
Olfr620	T	A	7: 103,611,772	I194F	possibly damaging	Het
Pecam1	A	G	11: 106,671,750	V708A	probably benign	Het
Pinlyp	C	T	7: 24,542,440		probably null	Het
Polh	G	A	17: 46,175,248	R382W	probably damaging	Het
Prdm10	A	G	9: 31,327,474	I221V	probably benign	Het
Pskh1	G	T	8: 105,913,090	R134L	probably benign	Het
Ptpre	A	G	7: 135,651,995	N6D	probably benign	Het
Rasgrp4	C	T	7: 29,150,610	P58L	unknown	Het
Rhbdf2	G	T	11: 116,602,240	C393*	probably null	Het
Ryr2	T	A	13: 11,706,623	R2641*	probably null	Het
Simc1	A	G	13: 54,524,832	H331R	probably benign	Het
Skp2	A	G	15: 9,122,241	S256P	probably benign	Het
Smarcd2	T	C	11: 106,267,566	R10G	probably benign	Het
Spef2	A	G	15: 9,687,895	L480P	possibly damaging	Het
Tenm4	A	G	7: 96,873,874	H1541R	probably damaging	Het
Top1	T	A	2: 160,714,088	L489Q	probably damaging	Het
Ttll13	C	T	7: 80,254,097	H258Y	probably damaging	Het
Unc80	A	G	1: 66,483,349	R237G	possibly damaging	Het
Vmn1r55	A	G	7: 5,146,624	F267L	probably benign	Het
Vmn2r96	T	A	17: 18,597,868	M761K	possibly damaging	Het
Vps33a	G	A	5: 123,570,979	H58Y	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp467	T	C	6: 48,439,181	Q179R	probably damaging	Het
Zfp729a	A	T	13: 67,619,948	S721T	possibly damaging	Het

Other mutations in Rlf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Rlf	APN	4	121170686	missense	possibly damaging	0.89
IGL00558:Rlf	APN	4	121150973	missense	probably damaging	1.00
IGL00990:Rlf	APN	4	121148339	missense	possibly damaging	0.87
IGL01625:Rlf	APN	4	121188260	missense	possibly damaging	0.68
IGL01921:Rlf	APN	4	121146746	missense	probably damaging	1.00
IGL01986:Rlf	APN	4	121148106	missense	probably damaging	1.00
IGL02232:Rlf	APN	4	121182614	missense	probably benign	0.21
IGL02586:Rlf	APN	4	121150064	missense	probably damaging	1.00
IGL03177:Rlf	APN	4	121148079	nonsense	probably null
IGL03233:Rlf	APN	4	121182600	splice site	probably benign
IGL03293:Rlf	APN	4	121148330	missense	probably benign	0.18
Brady	UTSW	4	121148553	nonsense	probably null
bunch	UTSW	4	121154975	missense	probably damaging	1.00
Rosary	UTSW	4	121148610	missense	probably damaging	0.99
transsubstantiation	UTSW	4	121148291	missense	probably benign	0.10
wafer	UTSW	4	121150532	missense	probably benign	0.00
Wine	UTSW	4	121148172	missense	probably damaging	1.00
PIT4651001:Rlf	UTSW	4	121150313	missense	probably damaging	0.98
R0019:Rlf	UTSW	4	121146572	missense	possibly damaging	0.46
R0019:Rlf	UTSW	4	121146572	missense	possibly damaging	0.46
R0039:Rlf	UTSW	4	121146842	missense	possibly damaging	0.90
R0041:Rlf	UTSW	4	121149929	missense	probably damaging	1.00
R0041:Rlf	UTSW	4	121149929	missense	probably damaging	1.00
R0590:Rlf	UTSW	4	121170833	splice site	probably benign
R1562:Rlf	UTSW	4	121150391	missense	possibly damaging	0.47
R1585:Rlf	UTSW	4	121148291	missense	probably benign	0.10
R1627:Rlf	UTSW	4	121150000	missense	probably benign	0.34
R1709:Rlf	UTSW	4	121149823	missense	probably benign	0.00
R1968:Rlf	UTSW	4	121148420	missense	probably damaging	1.00
R1982:Rlf	UTSW	4	121150112	missense	probably damaging	1.00
R3120:Rlf	UTSW	4	121149483	missense	probably benign	0.01
R3155:Rlf	UTSW	4	121149332	missense	probably damaging	1.00
R3162:Rlf	UTSW	4	121148847	missense	probably damaging	1.00
R3162:Rlf	UTSW	4	121148847	missense	probably damaging	1.00
R3429:Rlf	UTSW	4	121150532	missense	probably benign	0.00
R3430:Rlf	UTSW	4	121150532	missense	probably benign	0.00
R3700:Rlf	UTSW	4	121150863	missense	possibly damaging	0.77
R3732:Rlf	UTSW	4	121148324	missense	probably benign
R3909:Rlf	UTSW	4	121149032	missense	probably benign	0.00
R4033:Rlf	UTSW	4	121147343	missense	probably damaging	1.00
R4350:Rlf	UTSW	4	121149096	missense	probably benign	0.16
R4654:Rlf	UTSW	4	121150601	missense	probably benign	0.28
R4976:Rlf	UTSW	4	121147455	missense	probably damaging	0.98
R5060:Rlf	UTSW	4	121146866	missense	probably benign	0.00
R5105:Rlf	UTSW	4	121150367	missense	probably damaging	1.00
R5119:Rlf	UTSW	4	121147455	missense	probably damaging	0.98
R5150:Rlf	UTSW	4	121148172	missense	probably damaging	1.00
R5198:Rlf	UTSW	4	121148553	nonsense	probably null
R5214:Rlf	UTSW	4	121150700	missense	probably damaging	1.00
R6084:Rlf	UTSW	4	121149215	missense	possibly damaging	0.95
R6131:Rlf	UTSW	4	121154975	missense	probably damaging	1.00
R6188:Rlf	UTSW	4	121170766	missense	probably damaging	1.00
R6313:Rlf	UTSW	4	121148610	missense	probably damaging	0.99
R6332:Rlf	UTSW	4	121148822	missense	possibly damaging	0.75
R6341:Rlf	UTSW	4	121149360	nonsense	probably null
R6413:Rlf	UTSW	4	121147325	missense	probably damaging	1.00
R6683:Rlf	UTSW	4	121147926	missense	probably damaging	1.00
R7066:Rlf	UTSW	4	121148787	missense	probably benign
R7413:Rlf	UTSW	4	121150100	missense	probably damaging	1.00
R7640:Rlf	UTSW	4	121146801	missense	possibly damaging	0.96
R7641:Rlf	UTSW	4	121159196	missense	probably damaging	1.00
R8127:Rlf	UTSW	4	121147896	missense	possibly damaging	0.89
R8146:Rlf	UTSW	4	121147232	missense	probably benign	0.16
R8182:Rlf	UTSW	4	121150905	missense	possibly damaging	0.94
R8350:Rlf	UTSW	4	121170757	missense	probably damaging	0.98
R8375:Rlf	UTSW	4	121148335	missense	probably damaging	0.96
R8754:Rlf	UTSW	4	121146813	missense	possibly damaging	0.90
R8837:Rlf	UTSW	4	121188235	missense	probably benign	0.06
R8901:Rlf	UTSW	4	121146813	missense	possibly damaging	0.90
R9054:Rlf	UTSW	4	121150587	missense	possibly damaging	0.47
R9090:Rlf	UTSW	4	121147554	missense	probably benign
R9144:Rlf	UTSW	4	121146703	missense	probably benign	0.16
R9265:Rlf	UTSW	4	121150290	missense	possibly damaging	0.63
R9271:Rlf	UTSW	4	121147554	missense	probably benign
R9549:Rlf	UTSW	4	121148123	missense	probably damaging	1.00
R9550:Rlf	UTSW	4	121146423	missense	probably damaging	1.00
R9570:Rlf	UTSW	4	121149890	missense	possibly damaging	0.90
R9627:Rlf	UTSW	4	121149805	nonsense	probably null
R9652:Rlf	UTSW	4	121150668	missense	probably damaging	1.00
Z1176:Rlf	UTSW	4	121150428	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAGGAACTCCATATGAGAATCA -3'
(R):5'- AAATGGCAGGCTAGACAGGT -3'

Sequencing Primer
(F):5'- GTTTGAAACTGTAACAGGCTGACC -3'
(R):5'- TGGCAGGCTAGACAGGTAATAGTTAC -3'

Posted On

2019-12-20