Mutagenetix > Incidental Mutation

Incidental Mutation 'R7855:Cd38'

607175

Institutional Source

Beutler Lab

Gene Symbol

Cd38

Ensembl Gene

ENSMUSG00000029084

Gene Name

CD38 antigen

Synonyms

Cd38-rs1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7855 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43868553-43912375 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 43901448 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 135 (L135M)

Ref Sequence

ENSEMBL: ENSMUSP00000030964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030964]

AlphaFold

P56528

PDB Structure

Crystal structure of the truncated extracellular domain of mouse CD38 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030964
AA Change: L135M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030964
Gene: ENSMUSG00000029084
AA Change: L135M

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
Pfam:Rib_hydrolayse	59	300	2.9e-104	PFAM

Meta Mutation Damage Score

0.8725

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Knockout mice deficient for this gene display altered humoral immune responses. In addition, knockout mice exhibit higher locomotor activity and defects in nurturing and social behaviors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene has resulted in an impaired antibody response to T cell dependent antigens and disrupted glucose-dependent insulin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	A	19: 7,422,256	I456N	probably damaging	Het
Abca6	A	T	11: 110,191,628	V1173D	probably benign	Het
Ace	A	T	11: 105,972,379	M327L	probably benign	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicdl2	C	T	17: 23,666,017	Q231*	probably null	Het
Brms1l	A	T	12: 55,866,053	D277V	possibly damaging	Het
Col6a3	G	T	1: 90,810,621	P1059T	possibly damaging	Het
Coro1c	A	T	5: 113,848,597	M262K	probably benign	Het
Cpxm2	G	T	7: 132,057,695	P481Q	possibly damaging	Het
Dnah12	G	T	14: 26,829,329	V2543F	probably benign	Het
Dock2	A	C	11: 34,273,698	D1145E	probably damaging	Het
Elf3	G	A	1: 135,254,352	R364W	probably damaging	Het
Eln	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	5: 134,711,081		probably benign	Het
Epha3	A	G	16: 63,773,560	I55T	probably damaging	Het
Fam69c	G	A	18: 84,730,046		probably benign	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Gm10436	A	T	12: 88,176,083	I450N	probably benign	Het
Gm11568	A	T	11: 99,858,184	T72S	unknown	Het
Gm21994	C	T	2: 150,255,146	R121Q	probably benign	Het
Gm5415	A	C	1: 32,546,033	I265M	probably damaging	Het
Igkv3-1	C	T	6: 70,704,069	A84V	probably benign	Het
Il1rl2	A	C	1: 40,343,119	Y197S	probably damaging	Het
Il2ra	T	C	2: 11,680,336	I161T	possibly damaging	Het
Itgb8	C	T	12: 119,166,772	R667H	probably benign	Het
Kcnh7	G	A	2: 62,837,194	Q334*	probably null	Het
Lctl	A	C	9: 64,133,216	R480S	possibly damaging	Het
Lrba	T	G	3: 86,315,430	I617S	possibly damaging	Het
Marf1	G	T	16: 14,114,201	H1651N	probably benign	Het
Mitf	T	A	6: 97,993,196	Y142N	probably damaging	Het
Olfr569	A	G	7: 102,887,628	V175A	probably benign	Het
Olfr620	T	A	7: 103,611,772	I194F	possibly damaging	Het
Pecam1	A	G	11: 106,671,750	V708A	probably benign	Het
Pinlyp	C	T	7: 24,542,440		probably null	Het
Polh	G	A	17: 46,175,248	R382W	probably damaging	Het
Prdm10	A	G	9: 31,327,474	I221V	probably benign	Het
Pskh1	G	T	8: 105,913,090	R134L	probably benign	Het
Ptpre	A	G	7: 135,651,995	N6D	probably benign	Het
Rasgrp4	C	T	7: 29,150,610	P58L	unknown	Het
Rhbdf2	G	T	11: 116,602,240	C393*	probably null	Het
Rlf	T	C	4: 121,182,691	I174M	possibly damaging	Het
Ryr2	T	A	13: 11,706,623	R2641*	probably null	Het
Simc1	A	G	13: 54,524,832	H331R	probably benign	Het
Skp2	A	G	15: 9,122,241	S256P	probably benign	Het
Smarcd2	T	C	11: 106,267,566	R10G	probably benign	Het
Spef2	A	G	15: 9,687,895	L480P	possibly damaging	Het
Tenm4	A	G	7: 96,873,874	H1541R	probably damaging	Het
Top1	T	A	2: 160,714,088	L489Q	probably damaging	Het
Ttll13	C	T	7: 80,254,097	H258Y	probably damaging	Het
Unc80	A	G	1: 66,483,349	R237G	possibly damaging	Het
Vmn1r55	A	G	7: 5,146,624	F267L	probably benign	Het
Vmn2r96	T	A	17: 18,597,868	M761K	possibly damaging	Het
Vps33a	G	A	5: 123,570,979	H58Y	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp467	T	C	6: 48,439,181	Q179R	probably damaging	Het
Zfp729a	A	T	13: 67,619,948	S721T	possibly damaging	Het

Other mutations in Cd38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Cd38	APN	5	43903597	missense	probably benign	0.04
IGL01691:Cd38	APN	5	43903586	splice site	probably benign
IGL02585:Cd38	APN	5	43910302	missense	probably damaging	1.00
paradiso	UTSW	5	43903585	splice site	probably null
IGL02796:Cd38	UTSW	5	43906213	missense	probably damaging	1.00
R0496:Cd38	UTSW	5	43868891	missense	probably damaging	1.00
R0855:Cd38	UTSW	5	43903585	splice site	probably null
R1621:Cd38	UTSW	5	43901524	missense	probably benign	0.00
R2353:Cd38	UTSW	5	43908011	critical splice donor site	probably null
R2366:Cd38	UTSW	5	43903590	splice site	probably benign
R2860:Cd38	UTSW	5	43901433	missense	probably damaging	1.00
R2861:Cd38	UTSW	5	43901433	missense	probably damaging	1.00
R4342:Cd38	UTSW	5	43869089	missense	probably benign	0.00
R4343:Cd38	UTSW	5	43869089	missense	probably benign	0.00
R4344:Cd38	UTSW	5	43869089	missense	probably benign	0.00
R4953:Cd38	UTSW	5	43907545	missense	possibly damaging	0.73
R5007:Cd38	UTSW	5	43906164	missense	probably damaging	1.00
R5371:Cd38	UTSW	5	43868883	missense	probably benign	0.01
R5699:Cd38	UTSW	5	43900386	missense	probably damaging	1.00
R6857:Cd38	UTSW	5	43906198	missense	probably damaging	0.99
R6945:Cd38	UTSW	5	43908006	missense	probably damaging	1.00
R7129:Cd38	UTSW	5	43910309	missense	probably benign	0.13
R7825:Cd38	UTSW	5	43901455	missense	probably damaging	1.00
R7852:Cd38	UTSW	5	43901448	missense	probably damaging	1.00
R7894:Cd38	UTSW	5	43900404	missense	probably damaging	1.00
R8133:Cd38	UTSW	5	43901448	missense	probably damaging	1.00
R8134:Cd38	UTSW	5	43901448	missense	probably damaging	1.00
R9041:Cd38	UTSW	5	43901557	critical splice donor site	probably null
R9558:Cd38	UTSW	5	43900450	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCTGTGGTAGACAATAGCAAAACTG -3'
(R):5'- CAAGTTCCCTTGCAGCTCAAAG -3'

Sequencing Primer
(F):5'- AGTGCATGTCATTTATTCTGATGG -3'
(R):5'- GCTCAAAGCTCCCTTCCCAC -3'

Posted On

2019-12-20