Incidental Mutation 'R7855:Zfp467'
ID607179
Institutional Source Beutler Lab
Gene Symbol Zfp467
Ensembl Gene ENSMUSG00000068551
Gene Namezinc finger protein 467
SynonymsEZI, MNCb-3350, 1190001I08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R7855 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location48427697-48445825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48439181 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 179 (Q179R)
Ref Sequence ENSEMBL: ENSMUSP00000110207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101443] [ENSMUST00000114556] [ENSMUST00000114558] [ENSMUST00000114559] [ENSMUST00000114560] [ENSMUST00000114561] [ENSMUST00000114563] [ENSMUST00000114564] [ENSMUST00000114566] [ENSMUST00000141449]
Predicted Effect probably benign
Transcript: ENSMUST00000101443
Predicted Effect probably benign
Transcript: ENSMUST00000114556
Predicted Effect probably benign
Transcript: ENSMUST00000114558
Predicted Effect probably benign
Transcript: ENSMUST00000114559
Predicted Effect probably damaging
Transcript: ENSMUST00000114560
AA Change: Q179R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110207
Gene: ENSMUSG00000068551
AA Change: Q179R

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
ZnF_C2H2 160 182 1.26e-2 SMART
ZnF_C2H2 188 210 1.67e-2 SMART
ZnF_C2H2 216 238 2.12e-4 SMART
ZnF_C2H2 244 266 5.9e-3 SMART
ZnF_C2H2 272 294 1.47e-3 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 355 377 9.58e-3 SMART
ZnF_C2H2 430 452 7.26e-3 SMART
ZnF_C2H2 458 480 1.56e-2 SMART
ZnF_C2H2 486 508 1.18e-2 SMART
ZnF_C2H2 514 536 3.11e-2 SMART
ZnF_C2H2 542 564 2.43e-4 SMART
low complexity region 567 585 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114561
AA Change: Q179R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110208
Gene: ENSMUSG00000068551
AA Change: Q179R

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
ZnF_C2H2 160 182 1.26e-2 SMART
ZnF_C2H2 188 210 1.67e-2 SMART
ZnF_C2H2 216 238 2.12e-4 SMART
ZnF_C2H2 244 266 5.9e-3 SMART
ZnF_C2H2 272 294 1.47e-3 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 355 377 9.58e-3 SMART
ZnF_C2H2 430 452 7.26e-3 SMART
ZnF_C2H2 458 480 1.56e-2 SMART
ZnF_C2H2 486 508 1.18e-2 SMART
ZnF_C2H2 514 536 3.11e-2 SMART
ZnF_C2H2 542 564 2.43e-4 SMART
low complexity region 567 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114563
Predicted Effect probably benign
Transcript: ENSMUST00000114564
Predicted Effect probably benign
Transcript: ENSMUST00000114566
Predicted Effect probably benign
Transcript: ENSMUST00000141449
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein whose function has not yet been elucidated in humans. However, the mouse ortholog of this protein enhances adipocyte differentiation and suppresses osteoblast differentiation in bone marrow. The mouse protein also is a transcription factor for several genes and can help recruit histone deacetylase complexes. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Zfp467
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Zfp467 UTSW 6 48438681 missense probably benign 0.00
R0234:Zfp467 UTSW 6 48438755 missense probably damaging 1.00
R0234:Zfp467 UTSW 6 48438755 missense probably damaging 1.00
R1509:Zfp467 UTSW 6 48438687 missense possibly damaging 0.95
R1517:Zfp467 UTSW 6 48438236 missense probably damaging 1.00
R1656:Zfp467 UTSW 6 48439079 missense possibly damaging 0.87
R2131:Zfp467 UTSW 6 48442661 missense probably damaging 0.98
R2912:Zfp467 UTSW 6 48439076 missense possibly damaging 0.95
R4696:Zfp467 UTSW 6 48439357 unclassified probably benign
R4714:Zfp467 UTSW 6 48427817 missense unknown
R4993:Zfp467 UTSW 6 48439029 missense probably damaging 1.00
R7038:Zfp467 UTSW 6 48438138 missense probably damaging 1.00
R7224:Zfp467 UTSW 6 48444969 critical splice donor site probably null
R7938:Zfp467 UTSW 6 48439181 missense probably damaging 0.99
R8073:Zfp467 UTSW 6 48438025 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCTGGCTGAAGCGTTTGC -3'
(R):5'- CCATGGATGGGCTTTCACAC -3'

Sequencing Primer
(F):5'- CGTTTGCCGCACTCAGC -3'
(R):5'- GGATGGGCTTTCACACAATTC -3'
Posted On2019-12-20