Incidental Mutation 'R7855:Or52r1'
ID 607187
Institutional Source Beutler Lab
Gene Symbol Or52r1
Ensembl Gene ENSMUSG00000062142
Gene Name olfactory receptor family 52 subfamily R member 1
Synonyms MOR30-1, GA_x6K02T2PBJ9-5599295-5598351, Olfr569
MMRRC Submission 045908-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7855 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102536414-102537358 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102536835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 175 (V175A)
Ref Sequence ENSEMBL: ENSMUSP00000149088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078191] [ENSMUST00000217024]
AlphaFold Q8VGZ2
Predicted Effect probably benign
Transcript: ENSMUST00000078191
AA Change: V175A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077321
Gene: ENSMUSG00000062142
AA Change: V175A

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.2e-113 PFAM
Pfam:7TM_GPCR_Srsx 37 229 1.3e-9 PFAM
Pfam:7tm_1 43 294 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217024
AA Change: V175A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,082,454 (GRCm39) V1173D probably benign Het
Ace A T 11: 105,863,205 (GRCm39) M327L probably benign Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bicdl2 C T 17: 23,884,991 (GRCm39) Q231* probably null Het
Brms1l A T 12: 55,912,838 (GRCm39) D277V possibly damaging Het
Cd38 C A 5: 44,058,790 (GRCm39) L135M probably damaging Het
Col6a3 G T 1: 90,738,343 (GRCm39) P1059T possibly damaging Het
Coro1c A T 5: 113,986,658 (GRCm39) M262K probably benign Het
Cpxm2 G T 7: 131,659,424 (GRCm39) P481Q possibly damaging Het
Dipk1c G A 18: 84,748,171 (GRCm39) probably benign Het
Dnah12 G T 14: 26,551,286 (GRCm39) V2543F probably benign Het
Dock2 A C 11: 34,223,698 (GRCm39) D1145E probably damaging Het
Elf3 G A 1: 135,182,090 (GRCm39) R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,739,935 (GRCm39) probably benign Het
Epha3 A G 16: 63,593,923 (GRCm39) I55T probably damaging Het
Gfer C A 17: 24,913,259 (GRCm39) D198Y probably damaging Het
Gm11568 A T 11: 99,749,010 (GRCm39) T72S unknown Het
Igkv3-1 C T 6: 70,681,053 (GRCm39) A84V probably benign Het
Il1rl2 A C 1: 40,382,279 (GRCm39) Y197S probably damaging Het
Il2ra T C 2: 11,685,147 (GRCm39) I161T possibly damaging Het
Itgb8 C T 12: 119,130,507 (GRCm39) R667H probably benign Het
Kcnh7 G A 2: 62,667,538 (GRCm39) Q334* probably null Het
Lctl A C 9: 64,040,498 (GRCm39) R480S possibly damaging Het
Lrba T G 3: 86,222,737 (GRCm39) I617S possibly damaging Het
Marf1 G T 16: 13,932,065 (GRCm39) H1651N probably benign Het
Mitf T A 6: 97,970,157 (GRCm39) Y142N probably damaging Het
Or51v14 T A 7: 103,260,979 (GRCm39) I194F possibly damaging Het
Pecam1 A G 11: 106,562,576 (GRCm39) V708A probably benign Het
Pinlyp C T 7: 24,241,865 (GRCm39) probably null Het
Polh G A 17: 46,486,174 (GRCm39) R382W probably damaging Het
Pramel51 A T 12: 88,142,853 (GRCm39) I450N probably benign Het
Prdm10 A G 9: 31,238,770 (GRCm39) I221V probably benign Het
Pskh1 G T 8: 106,639,722 (GRCm39) R134L probably benign Het
Ptpre A G 7: 135,253,724 (GRCm39) N6D probably benign Het
Rasgrp4 C T 7: 28,850,035 (GRCm39) P58L unknown Het
Rhbdf2 G T 11: 116,493,066 (GRCm39) C393* probably null Het
Rlf T C 4: 121,039,888 (GRCm39) I174M possibly damaging Het
Ryr2 T A 13: 11,721,509 (GRCm39) R2641* probably null Het
Semp2l1 A C 1: 32,585,114 (GRCm39) I265M probably damaging Het
Simc1 A G 13: 54,672,645 (GRCm39) H331R probably benign Het
Skp2 A G 15: 9,122,328 (GRCm39) S256P probably benign Het
Smarcd2 T C 11: 106,158,392 (GRCm39) R10G probably benign Het
Spef2 A G 15: 9,687,981 (GRCm39) L480P possibly damaging Het
Tenm4 A G 7: 96,523,081 (GRCm39) H1541R probably damaging Het
Top1 T A 2: 160,556,008 (GRCm39) L489Q probably damaging Het
Ttll13 C T 7: 79,903,845 (GRCm39) H258Y probably damaging Het
Unc80 A G 1: 66,522,508 (GRCm39) R237G possibly damaging Het
Vmn1r55 A G 7: 5,149,623 (GRCm39) F267L probably benign Het
Vmn2r96 T A 17: 18,818,130 (GRCm39) M761K possibly damaging Het
Vps33a G A 5: 123,709,042 (GRCm39) H58Y possibly damaging Het
Zfp1002 C T 2: 150,097,066 (GRCm39) R121Q probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp467 T C 6: 48,416,115 (GRCm39) Q179R probably damaging Het
Zfp729a A T 13: 67,768,067 (GRCm39) S721T possibly damaging Het
Zfta T A 19: 7,399,621 (GRCm39) I456N probably damaging Het
Other mutations in Or52r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Or52r1 APN 7 102,536,814 (GRCm39) missense probably damaging 1.00
IGL02505:Or52r1 APN 7 102,536,814 (GRCm39) missense probably damaging 1.00
IGL02885:Or52r1 APN 7 102,537,243 (GRCm39) missense possibly damaging 0.83
IGL03339:Or52r1 APN 7 102,536,989 (GRCm39) missense probably benign 0.02
R0383:Or52r1 UTSW 7 102,536,458 (GRCm39) missense possibly damaging 0.91
R1767:Or52r1 UTSW 7 102,536,833 (GRCm39) missense probably damaging 1.00
R1793:Or52r1 UTSW 7 102,537,250 (GRCm39) missense probably benign 0.44
R1812:Or52r1 UTSW 7 102,537,285 (GRCm39) missense probably benign 0.32
R6061:Or52r1 UTSW 7 102,537,158 (GRCm39) missense probably benign 0.31
R8155:Or52r1 UTSW 7 102,536,452 (GRCm39) missense probably benign 0.00
R8890:Or52r1 UTSW 7 102,536,699 (GRCm39) nonsense probably null
R9131:Or52r1 UTSW 7 102,537,186 (GRCm39) missense probably benign 0.07
R9188:Or52r1 UTSW 7 102,536,596 (GRCm39) missense possibly damaging 0.95
R9398:Or52r1 UTSW 7 102,537,000 (GRCm39) missense probably damaging 1.00
Z1177:Or52r1 UTSW 7 102,536,968 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTGAGGCGAGCTTCAC -3'
(R):5'- ACATGCCTTTTCTTCTGTGGAG -3'

Sequencing Primer
(F):5'- TTGAGGCGAGCTTCACCTGAG -3'
(R):5'- CTGGGGTGCTCATGACCATG -3'
Posted On 2019-12-20