Incidental Mutation 'R7855:Olfr569'
ID607187
Institutional Source Beutler Lab
Gene Symbol Olfr569
Ensembl Gene ENSMUSG00000062142
Gene Nameolfactory receptor 569
SynonymsMOR30-1, GA_x6K02T2PBJ9-5599295-5598351
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R7855 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102883709-102890882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102887628 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 175 (V175A)
Ref Sequence ENSEMBL: ENSMUSP00000149088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078191] [ENSMUST00000217024]
Predicted Effect probably benign
Transcript: ENSMUST00000078191
AA Change: V175A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077321
Gene: ENSMUSG00000062142
AA Change: V175A

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.2e-113 PFAM
Pfam:7TM_GPCR_Srsx 37 229 1.3e-9 PFAM
Pfam:7tm_1 43 294 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217024
AA Change: V175A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Olfr569
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Olfr569 APN 7 102887607 missense probably damaging 1.00
IGL02505:Olfr569 APN 7 102887607 missense probably damaging 1.00
IGL02885:Olfr569 APN 7 102888036 missense possibly damaging 0.83
IGL03339:Olfr569 APN 7 102887782 missense probably benign 0.02
R0383:Olfr569 UTSW 7 102887251 missense possibly damaging 0.91
R1767:Olfr569 UTSW 7 102887626 missense probably damaging 1.00
R1793:Olfr569 UTSW 7 102888043 missense probably benign 0.44
R1812:Olfr569 UTSW 7 102888078 missense probably benign 0.32
R6061:Olfr569 UTSW 7 102887951 missense probably benign 0.31
R7938:Olfr569 UTSW 7 102887628 missense probably benign 0.01
Z1177:Olfr569 UTSW 7 102887761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTGAGGCGAGCTTCAC -3'
(R):5'- ACATGCCTTTTCTTCTGTGGAG -3'

Sequencing Primer
(F):5'- TTGAGGCGAGCTTCACCTGAG -3'
(R):5'- CTGGGGTGCTCATGACCATG -3'
Posted On2019-12-20