Incidental Mutation 'R7855:Ptpre'
ID607190
Institutional Source Beutler Lab
Gene Symbol Ptpre
Ensembl Gene ENSMUSG00000041836
Gene Nameprotein tyrosine phosphatase, receptor type, E
SynonymsPTPe, RPTPepsilon, PTPepsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.619) question?
Stock #R7855 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location135537481-135686293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135651995 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 6 (N6D)
Ref Sequence ENSEMBL: ENSMUSP00000147613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073961] [ENSMUST00000209256] [ENSMUST00000209979] [ENSMUST00000210833] [ENSMUST00000211140] [ENSMUST00000211788]
Predicted Effect probably benign
Transcript: ENSMUST00000073961
SMART Domains Protein: ENSMUSP00000073616
Gene: ENSMUSG00000041836

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
PTPc 133 395 4.65e-136 SMART
PTPc 424 690 7.36e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209256
Predicted Effect probably benign
Transcript: ENSMUST00000209979
AA Change: N6D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210833
Predicted Effect probably benign
Transcript: ENSMUST00000211140
Predicted Effect probably benign
Transcript: ENSMUST00000211788
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset peripheral myelination defects, increased activity of voltage-gated potassium channels in Schwann cells, and increased trabecular bone mass due to cell-specific defects in osteoclast function in young females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Ptpre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Ptpre APN 7 135659053 missense probably damaging 0.98
IGL01019:Ptpre APN 7 135678325 nonsense probably null
IGL01115:Ptpre APN 7 135670764 missense probably damaging 1.00
IGL01456:Ptpre APN 7 135669802 missense probably damaging 1.00
IGL01516:Ptpre APN 7 135664999 missense probably damaging 0.97
IGL02108:Ptpre APN 7 135659102 missense possibly damaging 0.85
IGL02735:Ptpre APN 7 135667567 missense probably damaging 1.00
IGL03326:Ptpre APN 7 135672817 missense probably damaging 1.00
IGL03327:Ptpre APN 7 135672822 critical splice donor site probably null
R0183:Ptpre UTSW 7 135669845 missense probably benign 0.01
R0369:Ptpre UTSW 7 135670715 missense probably damaging 1.00
R0538:Ptpre UTSW 7 135663315 missense probably damaging 0.99
R0762:Ptpre UTSW 7 135679235 missense probably damaging 0.99
R1169:Ptpre UTSW 7 135667612 missense probably benign 0.33
R1214:Ptpre UTSW 7 135679258 missense probably damaging 1.00
R1629:Ptpre UTSW 7 135669799 missense probably damaging 1.00
R1654:Ptpre UTSW 7 135653928 missense probably benign 0.32
R1819:Ptpre UTSW 7 135668993 splice site probably benign
R1876:Ptpre UTSW 7 135678317 missense possibly damaging 0.73
R2049:Ptpre UTSW 7 135670695 splice site probably benign
R2284:Ptpre UTSW 7 135669781 missense probably benign 0.05
R2895:Ptpre UTSW 7 135643858 nonsense probably null
R4508:Ptpre UTSW 7 135669103 missense probably damaging 1.00
R4603:Ptpre UTSW 7 135667643 nonsense probably null
R4644:Ptpre UTSW 7 135651932 intron probably benign
R4863:Ptpre UTSW 7 135669132 missense probably benign 0.00
R4989:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5015:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5133:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5134:Ptpre UTSW 7 135652092 missense probably damaging 0.96
R5291:Ptpre UTSW 7 135678301 missense probably benign
R5372:Ptpre UTSW 7 135653940 missense possibly damaging 0.87
R5653:Ptpre UTSW 7 135653943 missense probably damaging 0.99
R5896:Ptpre UTSW 7 135674278 missense probably benign 0.39
R6238:Ptpre UTSW 7 135671180 missense probably damaging 1.00
R6974:Ptpre UTSW 7 135669148 missense possibly damaging 0.95
R7125:Ptpre UTSW 7 135654015 nonsense probably null
R7298:Ptpre UTSW 7 135683287 missense probably damaging 1.00
R7453:Ptpre UTSW 7 135538074 missense unknown
R7459:Ptpre UTSW 7 135667600 missense probably benign
R7970:Ptpre UTSW 7 135678319 missense possibly damaging 0.51
R8003:Ptpre UTSW 7 135669036 missense probably damaging 0.96
R8768:Ptpre UTSW 7 135681577 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCCCTGGAAAGAACTGAAGG -3'
(R):5'- GCCCAGTGTACAATACCTTGC -3'

Sequencing Primer
(F):5'- TAGCATGGGGGAAGTCCTTAC -3'
(R):5'- GCTCTTCTAAGATCCCGTTAGG -3'
Posted On2019-12-20