Mutagenetix > Incidental Mutation

Incidental Mutation 'R7855:Ptpre'

607190

Institutional Source

Beutler Lab

Gene Symbol

Ptpre

Ensembl Gene

ENSMUSG00000041836

Gene Name

protein tyrosine phosphatase, receptor type, E

Synonyms

PTPe, RPTPepsilon, PTPepsilon

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.523) question?

Stock #

R7855 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

135537481-135686293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135651995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 6 (N6D)

Ref Sequence

ENSEMBL: ENSMUSP00000147613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073961] [ENSMUST00000209256] [ENSMUST00000209979] [ENSMUST00000210833] [ENSMUST00000211140] [ENSMUST00000211788]

AlphaFold

P49446

Predicted Effect

probably benign
Transcript: ENSMUST00000073961

SMART Domains

Protein: ENSMUSP00000073616
Gene: ENSMUSG00000041836

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	25	36	N/A	INTRINSIC
transmembrane domain	48	70	N/A	INTRINSIC
PTPc	133	395	4.65e-136	SMART
PTPc	424	690	7.36e-116	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000209256

Predicted Effect

probably benign
Transcript: ENSMUST00000209979
AA Change: N6D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000210833

Predicted Effect

probably benign
Transcript: ENSMUST00000211140

Predicted Effect

probably benign
Transcript: ENSMUST00000211788

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset peripheral myelination defects, increased activity of voltage-gated potassium channels in Schwann cells, and increased trabecular bone mass due to cell-specific defects in osteoclast function in young females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	A	19: 7,422,256	I456N	probably damaging	Het
Abca6	A	T	11: 110,191,628	V1173D	probably benign	Het
Ace	A	T	11: 105,972,379	M327L	probably benign	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicdl2	C	T	17: 23,666,017	Q231*	probably null	Het
Brms1l	A	T	12: 55,866,053	D277V	possibly damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Col6a3	G	T	1: 90,810,621	P1059T	possibly damaging	Het
Coro1c	A	T	5: 113,848,597	M262K	probably benign	Het
Cpxm2	G	T	7: 132,057,695	P481Q	possibly damaging	Het
Dnah12	G	T	14: 26,829,329	V2543F	probably benign	Het
Dock2	A	C	11: 34,273,698	D1145E	probably damaging	Het
Elf3	G	A	1: 135,254,352	R364W	probably damaging	Het
Eln	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	5: 134,711,081		probably benign	Het
Epha3	A	G	16: 63,773,560	I55T	probably damaging	Het
Fam69c	G	A	18: 84,730,046		probably benign	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Gm10436	A	T	12: 88,176,083	I450N	probably benign	Het
Gm11568	A	T	11: 99,858,184	T72S	unknown	Het
Gm21994	C	T	2: 150,255,146	R121Q	probably benign	Het
Gm5415	A	C	1: 32,546,033	I265M	probably damaging	Het
Igkv3-1	C	T	6: 70,704,069	A84V	probably benign	Het
Il1rl2	A	C	1: 40,343,119	Y197S	probably damaging	Het
Il2ra	T	C	2: 11,680,336	I161T	possibly damaging	Het
Itgb8	C	T	12: 119,166,772	R667H	probably benign	Het
Kcnh7	G	A	2: 62,837,194	Q334*	probably null	Het
Lctl	A	C	9: 64,133,216	R480S	possibly damaging	Het
Lrba	T	G	3: 86,315,430	I617S	possibly damaging	Het
Marf1	G	T	16: 14,114,201	H1651N	probably benign	Het
Mitf	T	A	6: 97,993,196	Y142N	probably damaging	Het
Olfr569	A	G	7: 102,887,628	V175A	probably benign	Het
Olfr620	T	A	7: 103,611,772	I194F	possibly damaging	Het
Pecam1	A	G	11: 106,671,750	V708A	probably benign	Het
Pinlyp	C	T	7: 24,542,440		probably null	Het
Polh	G	A	17: 46,175,248	R382W	probably damaging	Het
Prdm10	A	G	9: 31,327,474	I221V	probably benign	Het
Pskh1	G	T	8: 105,913,090	R134L	probably benign	Het
Rasgrp4	C	T	7: 29,150,610	P58L	unknown	Het
Rhbdf2	G	T	11: 116,602,240	C393*	probably null	Het
Rlf	T	C	4: 121,182,691	I174M	possibly damaging	Het
Ryr2	T	A	13: 11,706,623	R2641*	probably null	Het
Simc1	A	G	13: 54,524,832	H331R	probably benign	Het
Skp2	A	G	15: 9,122,241	S256P	probably benign	Het
Smarcd2	T	C	11: 106,267,566	R10G	probably benign	Het
Spef2	A	G	15: 9,687,895	L480P	possibly damaging	Het
Tenm4	A	G	7: 96,873,874	H1541R	probably damaging	Het
Top1	T	A	2: 160,714,088	L489Q	probably damaging	Het
Ttll13	C	T	7: 80,254,097	H258Y	probably damaging	Het
Unc80	A	G	1: 66,483,349	R237G	possibly damaging	Het
Vmn1r55	A	G	7: 5,146,624	F267L	probably benign	Het
Vmn2r96	T	A	17: 18,597,868	M761K	possibly damaging	Het
Vps33a	G	A	5: 123,570,979	H58Y	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp467	T	C	6: 48,439,181	Q179R	probably damaging	Het
Zfp729a	A	T	13: 67,619,948	S721T	possibly damaging	Het

Other mutations in Ptpre

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00918:Ptpre	APN	7	135659053	missense	probably damaging	0.98
IGL01019:Ptpre	APN	7	135678325	nonsense	probably null
IGL01115:Ptpre	APN	7	135670764	missense	probably damaging	1.00
IGL01456:Ptpre	APN	7	135669802	missense	probably damaging	1.00
IGL01516:Ptpre	APN	7	135664999	missense	probably damaging	0.97
IGL02108:Ptpre	APN	7	135659102	missense	possibly damaging	0.85
IGL02735:Ptpre	APN	7	135667567	missense	probably damaging	1.00
IGL03326:Ptpre	APN	7	135672817	missense	probably damaging	1.00
IGL03327:Ptpre	APN	7	135672822	critical splice donor site	probably null
R0183:Ptpre	UTSW	7	135669845	missense	probably benign	0.01
R0369:Ptpre	UTSW	7	135670715	missense	probably damaging	1.00
R0538:Ptpre	UTSW	7	135663315	missense	probably damaging	0.99
R0762:Ptpre	UTSW	7	135679235	missense	probably damaging	0.99
R1169:Ptpre	UTSW	7	135667612	missense	probably benign	0.33
R1214:Ptpre	UTSW	7	135679258	missense	probably damaging	1.00
R1629:Ptpre	UTSW	7	135669799	missense	probably damaging	1.00
R1654:Ptpre	UTSW	7	135653928	missense	probably benign	0.32
R1819:Ptpre	UTSW	7	135668993	splice site	probably benign
R1876:Ptpre	UTSW	7	135678317	missense	possibly damaging	0.73
R2049:Ptpre	UTSW	7	135670695	splice site	probably benign
R2284:Ptpre	UTSW	7	135669781	missense	probably benign	0.05
R2895:Ptpre	UTSW	7	135643858	nonsense	probably null
R4508:Ptpre	UTSW	7	135669103	missense	probably damaging	1.00
R4603:Ptpre	UTSW	7	135667643	nonsense	probably null
R4644:Ptpre	UTSW	7	135651932	intron	probably benign
R4863:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R4989:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R5015:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R5133:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R5134:Ptpre	UTSW	7	135652092	missense	probably damaging	0.96
R5291:Ptpre	UTSW	7	135678301	missense	probably benign
R5372:Ptpre	UTSW	7	135653940	missense	possibly damaging	0.87
R5653:Ptpre	UTSW	7	135653943	missense	probably damaging	0.99
R5896:Ptpre	UTSW	7	135674278	missense	probably benign	0.39
R6238:Ptpre	UTSW	7	135671180	missense	probably damaging	1.00
R6974:Ptpre	UTSW	7	135669148	missense	possibly damaging	0.95
R7125:Ptpre	UTSW	7	135654015	nonsense	probably null
R7298:Ptpre	UTSW	7	135683287	missense	probably damaging	1.00
R7453:Ptpre	UTSW	7	135538074	missense	unknown
R7459:Ptpre	UTSW	7	135667600	missense	probably benign
R7970:Ptpre	UTSW	7	135678319	missense	possibly damaging	0.51
R8003:Ptpre	UTSW	7	135669036	missense	probably damaging	0.96
R8768:Ptpre	UTSW	7	135681577	missense	possibly damaging	0.92
R9109:Ptpre	UTSW	7	135669779	missense	probably benign
R9131:Ptpre	UTSW	7	135679146	missense	probably damaging	1.00
R9267:Ptpre	UTSW	7	135672820	missense	probably damaging	1.00
R9541:Ptpre	UTSW	7	135665011	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- TCCCCTGGAAAGAACTGAAGG -3'
(R):5'- GCCCAGTGTACAATACCTTGC -3'

Sequencing Primer
(F):5'- TAGCATGGGGGAAGTCCTTAC -3'
(R):5'- GCTCTTCTAAGATCCCGTTAGG -3'

Posted On

2019-12-20