Mutagenetix > Incidental Mutation

Incidental Mutation 'R7855:Prdm10'

607192

Institutional Source

Beutler Lab

Gene Symbol

Prdm10

Ensembl Gene

ENSMUSG00000042496

Gene Name

PR domain containing 10

Synonyms

tristanin, LOC382066

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7855 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31280538-31381723 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31327474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 221 (I221V)

Ref Sequence

ENSEMBL: ENSMUSP00000112588 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074510] [ENSMUST00000117389] [ENSMUST00000215499] [ENSMUST00000215847]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000074510
AA Change: I172V

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000074104
Gene: ENSMUSG00000042496
AA Change: I172V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	111	117	N/A	INTRINSIC
PDB:3IHX\|D	133	284	1e-104	PDB
Blast:SET	165	277	3e-32	BLAST
ZnF_C2H2	300	322	5.42e-2	SMART
Pfam:Tristanin_u2	325	455	2.4e-49	PFAM
ZnF_C2H2	471	493	7.78e-3	SMART
ZnF_C2H2	501	523	1.95e-3	SMART
ZnF_C2H2	529	551	3.83e-2	SMART
ZnF_C2H2	557	580	8.34e-3	SMART
ZnF_C2H2	585	607	3.21e-4	SMART
ZnF_C2H2	613	636	3.69e-4	SMART
ZnF_C2H2	668	691	8.22e-2	SMART
ZnF_C2H2	801	824	1.25e-1	SMART
low complexity region	904	916	N/A	INTRINSIC
low complexity region	956	964	N/A	INTRINSIC
low complexity region	988	1007	N/A	INTRINSIC
low complexity region	1110	1122	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117389
AA Change: I221V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000112588
Gene: ENSMUSG00000042496
AA Change: I221V

Domain	Start	End	E-Value	Type
coiled coil region	119	150	N/A	INTRINSIC
PDB:3IHX\|D	182	317	2e-97	PDB
Blast:SET	214	317	2e-25	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000215499
AA Change: I203V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000215847
AA Change: I221V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that contains C2H2-type zinc-fingers. It also contains a positive regulatory domain, which has been found in several other zinc-finger transcription factors including those involved in B cell differentiation and tumor suppression. Studies of the mouse counterpart suggest that this protein may be involved in the development of the central nerve system (CNS), as well as in the pathogenesis of neuronal storage disease. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	A	19: 7,422,256	I456N	probably damaging	Het
Abca6	A	T	11: 110,191,628	V1173D	probably benign	Het
Ace	A	T	11: 105,972,379	M327L	probably benign	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicdl2	C	T	17: 23,666,017	Q231*	probably null	Het
Brms1l	A	T	12: 55,866,053	D277V	possibly damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Col6a3	G	T	1: 90,810,621	P1059T	possibly damaging	Het
Coro1c	A	T	5: 113,848,597	M262K	probably benign	Het
Cpxm2	G	T	7: 132,057,695	P481Q	possibly damaging	Het
Dnah12	G	T	14: 26,829,329	V2543F	probably benign	Het
Dock2	A	C	11: 34,273,698	D1145E	probably damaging	Het
Elf3	G	A	1: 135,254,352	R364W	probably damaging	Het
Eln	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	5: 134,711,081		probably benign	Het
Epha3	A	G	16: 63,773,560	I55T	probably damaging	Het
Fam69c	G	A	18: 84,730,046		probably benign	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Gm10436	A	T	12: 88,176,083	I450N	probably benign	Het
Gm11568	A	T	11: 99,858,184	T72S	unknown	Het
Gm21994	C	T	2: 150,255,146	R121Q	probably benign	Het
Gm5415	A	C	1: 32,546,033	I265M	probably damaging	Het
Igkv3-1	C	T	6: 70,704,069	A84V	probably benign	Het
Il1rl2	A	C	1: 40,343,119	Y197S	probably damaging	Het
Il2ra	T	C	2: 11,680,336	I161T	possibly damaging	Het
Itgb8	C	T	12: 119,166,772	R667H	probably benign	Het
Kcnh7	G	A	2: 62,837,194	Q334*	probably null	Het
Lctl	A	C	9: 64,133,216	R480S	possibly damaging	Het
Lrba	T	G	3: 86,315,430	I617S	possibly damaging	Het
Marf1	G	T	16: 14,114,201	H1651N	probably benign	Het
Mitf	T	A	6: 97,993,196	Y142N	probably damaging	Het
Olfr569	A	G	7: 102,887,628	V175A	probably benign	Het
Olfr620	T	A	7: 103,611,772	I194F	possibly damaging	Het
Pecam1	A	G	11: 106,671,750	V708A	probably benign	Het
Pinlyp	C	T	7: 24,542,440		probably null	Het
Polh	G	A	17: 46,175,248	R382W	probably damaging	Het
Pskh1	G	T	8: 105,913,090	R134L	probably benign	Het
Ptpre	A	G	7: 135,651,995	N6D	probably benign	Het
Rasgrp4	C	T	7: 29,150,610	P58L	unknown	Het
Rhbdf2	G	T	11: 116,602,240	C393*	probably null	Het
Rlf	T	C	4: 121,182,691	I174M	possibly damaging	Het
Ryr2	T	A	13: 11,706,623	R2641*	probably null	Het
Simc1	A	G	13: 54,524,832	H331R	probably benign	Het
Skp2	A	G	15: 9,122,241	S256P	probably benign	Het
Smarcd2	T	C	11: 106,267,566	R10G	probably benign	Het
Spef2	A	G	15: 9,687,895	L480P	possibly damaging	Het
Tenm4	A	G	7: 96,873,874	H1541R	probably damaging	Het
Top1	T	A	2: 160,714,088	L489Q	probably damaging	Het
Ttll13	C	T	7: 80,254,097	H258Y	probably damaging	Het
Unc80	A	G	1: 66,483,349	R237G	possibly damaging	Het
Vmn1r55	A	G	7: 5,146,624	F267L	probably benign	Het
Vmn2r96	T	A	17: 18,597,868	M761K	possibly damaging	Het
Vps33a	G	A	5: 123,570,979	H58Y	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp467	T	C	6: 48,439,181	Q179R	probably damaging	Het
Zfp729a	A	T	13: 67,619,948	S721T	possibly damaging	Het

Other mutations in Prdm10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Prdm10	APN	9	31360812	splice site	probably benign
IGL00485:Prdm10	APN	9	31327546	missense	possibly damaging	0.87
IGL00757:Prdm10	APN	9	31318546	missense	possibly damaging	0.69
IGL00836:Prdm10	APN	9	31329869	splice site	probably benign
IGL01505:Prdm10	APN	9	31327282	missense	probably benign
IGL01594:Prdm10	APN	9	31346853	missense	probably damaging	1.00
IGL01894:Prdm10	APN	9	31316261	missense	probably damaging	1.00
IGL01927:Prdm10	APN	9	31335398	splice site	probably benign
IGL02053:Prdm10	APN	9	31360848	missense	probably benign	0.00
IGL02068:Prdm10	APN	9	31337350	missense	probably damaging	1.00
IGL02295:Prdm10	APN	9	31362368	missense	probably benign
IGL02390:Prdm10	APN	9	31353389	missense	possibly damaging	0.68
IGL02574:Prdm10	APN	9	31357293	missense	probably damaging	1.00
IGL02636:Prdm10	APN	9	31329681	missense	possibly damaging	0.68
IGL02883:Prdm10	APN	9	31327348	missense	probably damaging	0.99
IGL03057:Prdm10	APN	9	31349185	missense	probably damaging	1.00
PIT4142001:Prdm10	UTSW	9	31325767	missense	probably benign	0.00
R0089:Prdm10	UTSW	9	31316230	missense	probably damaging	1.00
R0149:Prdm10	UTSW	9	31316159	splice site	probably benign
R0306:Prdm10	UTSW	9	31316224	missense	probably damaging	1.00
R0386:Prdm10	UTSW	9	31316300	missense	probably damaging	1.00
R0390:Prdm10	UTSW	9	31349268	critical splice donor site	probably null
R1512:Prdm10	UTSW	9	31337401	missense	probably damaging	1.00
R1528:Prdm10	UTSW	9	31357286	missense	probably damaging	1.00
R2409:Prdm10	UTSW	9	31349122	missense	possibly damaging	0.81
R3745:Prdm10	UTSW	9	31340407	missense	possibly damaging	0.72
R3929:Prdm10	UTSW	9	31347136	missense	probably damaging	1.00
R4295:Prdm10	UTSW	9	31316294	missense	possibly damaging	0.94
R4629:Prdm10	UTSW	9	31337316	nonsense	probably null
R4660:Prdm10	UTSW	9	31327328	missense	probably damaging	1.00
R4758:Prdm10	UTSW	9	31362412	missense	probably benign	0.00
R4793:Prdm10	UTSW	9	31353405	missense	probably damaging	1.00
R4798:Prdm10	UTSW	9	31341273	missense	probably damaging	1.00
R4806:Prdm10	UTSW	9	31329941	makesense	probably null
R4865:Prdm10	UTSW	9	31347080	missense	probably damaging	1.00
R5068:Prdm10	UTSW	9	31359047	missense	probably damaging	0.96
R5093:Prdm10	UTSW	9	31341483	missense	probably damaging	1.00
R5162:Prdm10	UTSW	9	31340418	missense	possibly damaging	0.90
R5656:Prdm10	UTSW	9	31353417	missense	probably benign	0.08
R5855:Prdm10	UTSW	9	31337323	missense	probably damaging	1.00
R6242:Prdm10	UTSW	9	31341252	missense	possibly damaging	0.67
R6396:Prdm10	UTSW	9	31318546	missense	possibly damaging	0.69
R6970:Prdm10	UTSW	9	31329823	nonsense	probably null
R7165:Prdm10	UTSW	9	31316442	splice site	probably null
R7177:Prdm10	UTSW	9	31367707	missense	probably benign
R7201:Prdm10	UTSW	9	31316306	missense	possibly damaging	0.87
R7313:Prdm10	UTSW	9	31357160	nonsense	probably null
R7337:Prdm10	UTSW	9	31316241	missense	probably damaging	1.00
R7511:Prdm10	UTSW	9	31378481	missense	probably damaging	1.00
R7711:Prdm10	UTSW	9	31357232	missense	probably damaging	1.00
R7965:Prdm10	UTSW	9	31347006	missense	probably damaging	1.00
R7997:Prdm10	UTSW	9	31353425	missense	probably damaging	1.00
R8168:Prdm10	UTSW	9	31346967	missense	probably benign	0.00
R8717:Prdm10	UTSW	9	31341399	missense	probably benign	0.31
R8865:Prdm10	UTSW	9	31327397	missense	probably damaging	1.00
R8880:Prdm10	UTSW	9	31353446	missense	probably damaging	1.00
R9022:Prdm10	UTSW	9	31357128	missense	probably benign	0.01
R9200:Prdm10	UTSW	9	31357142	missense	probably damaging	1.00
R9288:Prdm10	UTSW	9	31341378	missense	possibly damaging	0.67
R9607:Prdm10	UTSW	9	31349190	missense	probably damaging	1.00
RF004:Prdm10	UTSW	9	31359126	missense	probably damaging	1.00
X0064:Prdm10	UTSW	9	31362451	missense	probably damaging	1.00
Z1176:Prdm10	UTSW	9	31316168	missense	possibly damaging	0.95
Z1176:Prdm10	UTSW	9	31316293	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAGCTCGCTTTCTCTTGCAGG -3'
(R):5'- TGCAGACCAAGCTTCCATAG -3'

Sequencing Primer
(F):5'- GGTGTGAGGAGTGTAACAATGCAC -3'
(R):5'- GCAAATAGCTGGTGTGATCTG -3'

Posted On

2019-12-20