Incidental Mutation 'R7855:Lctl'
ID607193
Institutional Source Beutler Lab
Gene Symbol Lctl
Ensembl Gene ENSMUSG00000032401
Gene Namelactase-like
SynonymsE130104I05Rik, KLPH
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7855 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64117147-64138118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 64133216 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 480 (R480S)
Ref Sequence ENSEMBL: ENSMUSP00000034969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034969] [ENSMUST00000118215] [ENSMUST00000122091] [ENSMUST00000124020] [ENSMUST00000176299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034969
AA Change: R480S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034969
Gene: ENSMUSG00000032401
AA Change: R480S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 502 1.7e-161 PFAM
transmembrane domain 540 562 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118215
AA Change: R321S

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112979
Gene: ENSMUSG00000032401
AA Change: R321S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 1 343 5.8e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122091
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124020
SMART Domains Protein: ENSMUSP00000120815
Gene: ENSMUSG00000032401

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 235 2.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176299
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of family 1 glycosidases. Glycosidases are enzymes that hydrolyze glycosidic bonds and are classified into families based on primary amino acid sequence. Most members of family 1 have two conserved glutamic acid residues, which are required for enzymatic activity. The mouse ortholog of this protein has been characterized and has a domain structure of an N-terminal signal peptide, glycosidase domain, transmembrane domain, and a short cytoplasmic tail. It lacks one of the conserved glutamic acid residues important for catalysis, and its function remains to be determined (PMID: 12084582). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Lctl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Lctl APN 9 64133129 nonsense probably null
IGL03066:Lctl APN 9 64117735 start codon destroyed probably null 0.66
IGL03302:Lctl APN 9 64134848 unclassified probably benign
R0077:Lctl UTSW 9 64122107 start codon destroyed probably null 0.64
R0137:Lctl UTSW 9 64117698 utr 5 prime probably benign
R0335:Lctl UTSW 9 64118887 missense probably benign 0.00
R0391:Lctl UTSW 9 64122314 splice site probably benign
R1740:Lctl UTSW 9 64133107 missense probably damaging 1.00
R1866:Lctl UTSW 9 64131721 missense probably damaging 1.00
R2160:Lctl UTSW 9 64117767 missense probably benign 0.02
R2867:Lctl UTSW 9 64137868 missense probably benign 0.23
R2867:Lctl UTSW 9 64137868 missense probably benign 0.23
R3605:Lctl UTSW 9 64133193 missense probably damaging 1.00
R3607:Lctl UTSW 9 64133193 missense probably damaging 1.00
R4585:Lctl UTSW 9 64131600 missense probably damaging 1.00
R4861:Lctl UTSW 9 64119763 missense possibly damaging 0.55
R4861:Lctl UTSW 9 64119763 missense possibly damaging 0.55
R5249:Lctl UTSW 9 64137914 missense probably benign
R7021:Lctl UTSW 9 64132793 splice site probably null
R7106:Lctl UTSW 9 64132837 missense probably benign 0.22
R7221:Lctl UTSW 9 64118935 nonsense probably null
R7265:Lctl UTSW 9 64126921 missense probably damaging 1.00
R7353:Lctl UTSW 9 64126967 missense probably damaging 1.00
R7501:Lctl UTSW 9 64131579 missense probably benign 0.00
R7615:Lctl UTSW 9 64122110 missense probably damaging 1.00
R7938:Lctl UTSW 9 64133216 missense possibly damaging 0.89
RF014:Lctl UTSW 9 64118930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCGATGAGTGGAGAATC -3'
(R):5'- ATGGTGCCATATTCCCCACC -3'

Sequencing Primer
(F):5'- TGGAGAATCCAGTACCTCAAAG -3'
(R):5'- CCCCTCCTTTGAAAGAAAGAAGTGTG -3'
Posted On2019-12-20