Incidental Mutation 'R7855:Zfp354c'
ID 607195
Institutional Source Beutler Lab
Gene Symbol Zfp354c
Ensembl Gene ENSMUSG00000044807
Gene Name zinc finger protein 354C
Synonyms 5330421P20Rik, Kid3, AJ18
MMRRC Submission 045908-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7855 (G1)
Quality Score 217.468
Status Not validated
Chromosome 11
Chromosomal Location 50701913-50718551 bp(-) (GRCm39)
Type of Mutation small deletion (3 aa in frame mutation)
DNA Base Change (assembly) TCACACTCGGCACA to TCACA at 50706067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000632] [ENSMUST00000109135]
AlphaFold Q571J5
Predicted Effect probably benign
Transcript: ENSMUST00000000632
SMART Domains Protein: ENSMUSP00000000632
Gene: ENSMUSG00000044807

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109135
SMART Domains Protein: ENSMUSP00000104763
Gene: ENSMUSG00000044807

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,082,454 (GRCm39) V1173D probably benign Het
Ace A T 11: 105,863,205 (GRCm39) M327L probably benign Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bicdl2 C T 17: 23,884,991 (GRCm39) Q231* probably null Het
Brms1l A T 12: 55,912,838 (GRCm39) D277V possibly damaging Het
Cd38 C A 5: 44,058,790 (GRCm39) L135M probably damaging Het
Col6a3 G T 1: 90,738,343 (GRCm39) P1059T possibly damaging Het
Coro1c A T 5: 113,986,658 (GRCm39) M262K probably benign Het
Cpxm2 G T 7: 131,659,424 (GRCm39) P481Q possibly damaging Het
Dipk1c G A 18: 84,748,171 (GRCm39) probably benign Het
Dnah12 G T 14: 26,551,286 (GRCm39) V2543F probably benign Het
Dock2 A C 11: 34,223,698 (GRCm39) D1145E probably damaging Het
Elf3 G A 1: 135,182,090 (GRCm39) R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,739,935 (GRCm39) probably benign Het
Epha3 A G 16: 63,593,923 (GRCm39) I55T probably damaging Het
Gfer C A 17: 24,913,259 (GRCm39) D198Y probably damaging Het
Gm11568 A T 11: 99,749,010 (GRCm39) T72S unknown Het
Igkv3-1 C T 6: 70,681,053 (GRCm39) A84V probably benign Het
Il1rl2 A C 1: 40,382,279 (GRCm39) Y197S probably damaging Het
Il2ra T C 2: 11,685,147 (GRCm39) I161T possibly damaging Het
Itgb8 C T 12: 119,130,507 (GRCm39) R667H probably benign Het
Kcnh7 G A 2: 62,667,538 (GRCm39) Q334* probably null Het
Lctl A C 9: 64,040,498 (GRCm39) R480S possibly damaging Het
Lrba T G 3: 86,222,737 (GRCm39) I617S possibly damaging Het
Marf1 G T 16: 13,932,065 (GRCm39) H1651N probably benign Het
Mitf T A 6: 97,970,157 (GRCm39) Y142N probably damaging Het
Or51v14 T A 7: 103,260,979 (GRCm39) I194F possibly damaging Het
Or52r1 A G 7: 102,536,835 (GRCm39) V175A probably benign Het
Pecam1 A G 11: 106,562,576 (GRCm39) V708A probably benign Het
Pinlyp C T 7: 24,241,865 (GRCm39) probably null Het
Polh G A 17: 46,486,174 (GRCm39) R382W probably damaging Het
Pramel51 A T 12: 88,142,853 (GRCm39) I450N probably benign Het
Prdm10 A G 9: 31,238,770 (GRCm39) I221V probably benign Het
Pskh1 G T 8: 106,639,722 (GRCm39) R134L probably benign Het
Ptpre A G 7: 135,253,724 (GRCm39) N6D probably benign Het
Rasgrp4 C T 7: 28,850,035 (GRCm39) P58L unknown Het
Rhbdf2 G T 11: 116,493,066 (GRCm39) C393* probably null Het
Rlf T C 4: 121,039,888 (GRCm39) I174M possibly damaging Het
Ryr2 T A 13: 11,721,509 (GRCm39) R2641* probably null Het
Semp2l1 A C 1: 32,585,114 (GRCm39) I265M probably damaging Het
Simc1 A G 13: 54,672,645 (GRCm39) H331R probably benign Het
Skp2 A G 15: 9,122,328 (GRCm39) S256P probably benign Het
Smarcd2 T C 11: 106,158,392 (GRCm39) R10G probably benign Het
Spef2 A G 15: 9,687,981 (GRCm39) L480P possibly damaging Het
Tenm4 A G 7: 96,523,081 (GRCm39) H1541R probably damaging Het
Top1 T A 2: 160,556,008 (GRCm39) L489Q probably damaging Het
Ttll13 C T 7: 79,903,845 (GRCm39) H258Y probably damaging Het
Unc80 A G 1: 66,522,508 (GRCm39) R237G possibly damaging Het
Vmn1r55 A G 7: 5,149,623 (GRCm39) F267L probably benign Het
Vmn2r96 T A 17: 18,818,130 (GRCm39) M761K possibly damaging Het
Vps33a G A 5: 123,709,042 (GRCm39) H58Y possibly damaging Het
Zfp1002 C T 2: 150,097,066 (GRCm39) R121Q probably benign Het
Zfp467 T C 6: 48,416,115 (GRCm39) Q179R probably damaging Het
Zfp729a A T 13: 67,768,067 (GRCm39) S721T possibly damaging Het
Zfta T A 19: 7,399,621 (GRCm39) I456N probably damaging Het
Other mutations in Zfp354c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Zfp354c APN 11 50,706,440 (GRCm39) missense probably damaging 0.97
IGL01615:Zfp354c APN 11 50,708,732 (GRCm39) missense possibly damaging 0.90
IGL03019:Zfp354c APN 11 50,708,021 (GRCm39) missense probably damaging 1.00
R0546:Zfp354c UTSW 11 50,706,457 (GRCm39) missense probably benign 0.12
R1370:Zfp354c UTSW 11 50,706,667 (GRCm39) missense probably benign
R2109:Zfp354c UTSW 11 50,707,969 (GRCm39) missense probably benign 0.01
R2850:Zfp354c UTSW 11 50,706,158 (GRCm39) nonsense probably null
R4010:Zfp354c UTSW 11 50,705,771 (GRCm39) missense probably damaging 0.98
R5034:Zfp354c UTSW 11 50,705,866 (GRCm39) missense probably benign 0.14
R5430:Zfp354c UTSW 11 50,706,022 (GRCm39) missense probably benign 0.02
R5439:Zfp354c UTSW 11 50,706,597 (GRCm39) missense probably benign 0.01
R5905:Zfp354c UTSW 11 50,706,253 (GRCm39) missense probably damaging 1.00
R6244:Zfp354c UTSW 11 50,705,798 (GRCm39) missense probably benign 0.41
R6264:Zfp354c UTSW 11 50,706,274 (GRCm39) missense probably benign 0.00
R6591:Zfp354c UTSW 11 50,705,602 (GRCm39) missense probably benign 0.41
R6650:Zfp354c UTSW 11 50,705,518 (GRCm39) missense probably damaging 1.00
R6691:Zfp354c UTSW 11 50,705,602 (GRCm39) missense probably benign 0.41
R7087:Zfp354c UTSW 11 50,706,040 (GRCm39) missense probably damaging 1.00
R7313:Zfp354c UTSW 11 50,705,483 (GRCm39) missense probably damaging 1.00
R7467:Zfp354c UTSW 11 50,706,253 (GRCm39) missense probably damaging 1.00
R7619:Zfp354c UTSW 11 50,708,635 (GRCm39) critical splice donor site probably null
R7699:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7710:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7712:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7747:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7748:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7784:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7816:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7817:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7853:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7870:Zfp354c UTSW 11 50,706,065 (GRCm39) small deletion probably benign
R8852:Zfp354c UTSW 11 50,706,019 (GRCm39) missense probably damaging 1.00
R8860:Zfp354c UTSW 11 50,706,019 (GRCm39) missense probably damaging 1.00
R8862:Zfp354c UTSW 11 50,708,718 (GRCm39) missense probably benign 0.15
R9169:Zfp354c UTSW 11 50,706,088 (GRCm39) missense probably damaging 1.00
R9215:Zfp354c UTSW 11 50,706,666 (GRCm39) missense probably benign 0.31
R9273:Zfp354c UTSW 11 50,706,059 (GRCm39) missense probably damaging 1.00
R9762:Zfp354c UTSW 11 50,706,239 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAAGGTTCTCCCACATTGC -3'
(R):5'- TGCTACGTATCACACTTCAGAG -3'

Sequencing Primer
(F):5'- TTGCAAACACTGGCAAAGCTG -3'
(R):5'- TCTTCTAGAGCACAAGAGGCTTC -3'
Posted On 2019-12-20