Mutagenetix > Incidental Mutation

Incidental Mutation 'R7855:Ace'

607197

Institutional Source

Beutler Lab

Gene Symbol

Ace

Ensembl Gene

ENSMUSG00000020681

Gene Name

angiotensin I converting enzyme (peptidyl-dipeptidase A) 1

Synonyms

CD143

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7855 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105967945-105989964 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105972379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 327 (M327L)

Ref Sequence

ENSEMBL: ENSMUSP00000001963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001963] [ENSMUST00000001964]

AlphaFold

P09470

Predicted Effect

probably benign
Transcript: ENSMUST00000001963
AA Change: M327L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000001963
Gene: ENSMUSG00000020681
AA Change: M327L

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:Peptidase_M2	45	628	7.1e-257	PFAM
Pfam:Peptidase_M2	648	1226	8.9e-261	PFAM
transmembrane domain	1264	1286	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000001964

SMART Domains

Protein: ENSMUSP00000001964
Gene: ENSMUSG00000020681

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Peptidase_M2	59	653	N/A	PFAM
transmembrane domain	684	706	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119826
Gene: ENSMUSG00000020681
AA Change: M93L

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M2	1	395	2.4e-201	PFAM
Pfam:Peptidase_M2	415	993	1.4e-261	PFAM
low complexity region	999	1014	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable phenotypes, including reduced systemic blood pressure, normocytic anemia, renal abnormalities, inability to concentrate urine, and reduced male fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	A	19: 7,422,256	I456N	probably damaging	Het
Abca6	A	T	11: 110,191,628	V1173D	probably benign	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicdl2	C	T	17: 23,666,017	Q231*	probably null	Het
Brms1l	A	T	12: 55,866,053	D277V	possibly damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Col6a3	G	T	1: 90,810,621	P1059T	possibly damaging	Het
Coro1c	A	T	5: 113,848,597	M262K	probably benign	Het
Cpxm2	G	T	7: 132,057,695	P481Q	possibly damaging	Het
Dnah12	G	T	14: 26,829,329	V2543F	probably benign	Het
Dock2	A	C	11: 34,273,698	D1145E	probably damaging	Het
Elf3	G	A	1: 135,254,352	R364W	probably damaging	Het
Eln	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	5: 134,711,081		probably benign	Het
Epha3	A	G	16: 63,773,560	I55T	probably damaging	Het
Fam69c	G	A	18: 84,730,046		probably benign	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Gm10436	A	T	12: 88,176,083	I450N	probably benign	Het
Gm11568	A	T	11: 99,858,184	T72S	unknown	Het
Gm21994	C	T	2: 150,255,146	R121Q	probably benign	Het
Gm5415	A	C	1: 32,546,033	I265M	probably damaging	Het
Igkv3-1	C	T	6: 70,704,069	A84V	probably benign	Het
Il1rl2	A	C	1: 40,343,119	Y197S	probably damaging	Het
Il2ra	T	C	2: 11,680,336	I161T	possibly damaging	Het
Itgb8	C	T	12: 119,166,772	R667H	probably benign	Het
Kcnh7	G	A	2: 62,837,194	Q334*	probably null	Het
Lctl	A	C	9: 64,133,216	R480S	possibly damaging	Het
Lrba	T	G	3: 86,315,430	I617S	possibly damaging	Het
Marf1	G	T	16: 14,114,201	H1651N	probably benign	Het
Mitf	T	A	6: 97,993,196	Y142N	probably damaging	Het
Olfr569	A	G	7: 102,887,628	V175A	probably benign	Het
Olfr620	T	A	7: 103,611,772	I194F	possibly damaging	Het
Pecam1	A	G	11: 106,671,750	V708A	probably benign	Het
Pinlyp	C	T	7: 24,542,440		probably null	Het
Polh	G	A	17: 46,175,248	R382W	probably damaging	Het
Prdm10	A	G	9: 31,327,474	I221V	probably benign	Het
Pskh1	G	T	8: 105,913,090	R134L	probably benign	Het
Ptpre	A	G	7: 135,651,995	N6D	probably benign	Het
Rasgrp4	C	T	7: 29,150,610	P58L	unknown	Het
Rhbdf2	G	T	11: 116,602,240	C393*	probably null	Het
Rlf	T	C	4: 121,182,691	I174M	possibly damaging	Het
Ryr2	T	A	13: 11,706,623	R2641*	probably null	Het
Simc1	A	G	13: 54,524,832	H331R	probably benign	Het
Skp2	A	G	15: 9,122,241	S256P	probably benign	Het
Smarcd2	T	C	11: 106,267,566	R10G	probably benign	Het
Spef2	A	G	15: 9,687,895	L480P	possibly damaging	Het
Tenm4	A	G	7: 96,873,874	H1541R	probably damaging	Het
Top1	T	A	2: 160,714,088	L489Q	probably damaging	Het
Ttll13	C	T	7: 80,254,097	H258Y	probably damaging	Het
Unc80	A	G	1: 66,483,349	R237G	possibly damaging	Het
Vmn1r55	A	G	7: 5,146,624	F267L	probably benign	Het
Vmn2r96	T	A	17: 18,597,868	M761K	possibly damaging	Het
Vps33a	G	A	5: 123,570,979	H58Y	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp467	T	C	6: 48,439,181	Q179R	probably damaging	Het
Zfp729a	A	T	13: 67,619,948	S721T	possibly damaging	Het

Other mutations in Ace

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00941:Ace	APN	11	105979550	missense	probably benign	0.21
IGL01105:Ace	APN	11	105972059	missense	probably damaging	1.00
IGL01761:Ace	APN	11	105979493	missense	possibly damaging	0.70
IGL01888:Ace	APN	11	105968944	missense	probably benign
IGL02173:Ace	APN	11	105988991	missense	probably benign	0.04
IGL02179:Ace	APN	11	105969789	missense	probably benign	0.16
IGL02331:Ace	APN	11	105971344	missense	possibly damaging	0.61
IGL02333:Ace	APN	11	105971447	missense	probably benign
IGL02556:Ace	APN	11	105972527	missense	probably damaging	1.00
IGL02576:Ace	APN	11	105974111	missense	probably damaging	1.00
IGL03202:Ace	APN	11	105976962	missense	probably damaging	1.00
R0403:Ace	UTSW	11	105973880	splice site	probably null
R0709:Ace	UTSW	11	105981538	missense	probably damaging	0.97
R1555:Ace	UTSW	11	105974901	splice site	probably null
R1603:Ace	UTSW	11	105972099	missense	probably benign	0.23
R1644:Ace	UTSW	11	105985106	missense	probably damaging	1.00
R1834:Ace	UTSW	11	105986094	splice site	probably benign
R2074:Ace	UTSW	11	105976623	nonsense	probably null
R3025:Ace	UTSW	11	105974093	splice site	probably null
R3176:Ace	UTSW	11	105976702	missense	probably null	1.00
R3276:Ace	UTSW	11	105976702	missense	probably null	1.00
R3977:Ace	UTSW	11	105981838	missense	possibly damaging	0.96
R4506:Ace	UTSW	11	105976666	missense	probably damaging	0.98
R4598:Ace	UTSW	11	105981759	splice site	probably null
R4914:Ace	UTSW	11	105979597	missense	probably damaging	1.00
R4968:Ace	UTSW	11	105981853	missense	possibly damaging	0.93
R5137:Ace	UTSW	11	105974826	missense	probably damaging	1.00
R5274:Ace	UTSW	11	105968037	missense	probably benign
R5332:Ace	UTSW	11	105973879	critical splice donor site	probably null
R5388:Ace	UTSW	11	105988458	missense	possibly damaging	0.85
R5425:Ace	UTSW	11	105973428	missense	probably damaging	1.00
R5640:Ace	UTSW	11	105970685	missense	probably damaging	1.00
R5838:Ace	UTSW	11	105972880	missense	probably benign	0.00
R6041:Ace	UTSW	11	105975308	missense	probably benign	0.27
R6083:Ace	UTSW	11	105985267	nonsense	probably null
R6106:Ace	UTSW	11	105989012	missense	probably damaging	1.00
R6225:Ace	UTSW	11	105979619	missense	possibly damaging	0.51
R6607:Ace	UTSW	11	105972377	missense	possibly damaging	0.82
R6918:Ace	UTSW	11	105972943	missense	probably damaging	1.00
R7330:Ace	UTSW	11	105986061	missense	probably damaging	1.00
R7471:Ace	UTSW	11	105973482	missense	probably damaging	1.00
R7709:Ace	UTSW	11	105988837	missense	probably benign	0.01
R7800:Ace	UTSW	11	105986058	missense	probably damaging	1.00
R7947:Ace	UTSW	11	105973054	missense	possibly damaging	0.81
R8063:Ace	UTSW	11	105971364	missense	possibly damaging	0.90
R8072:Ace	UTSW	11	105972959	missense	probably damaging	0.98
R8412:Ace	UTSW	11	105979266	missense	probably benign
R8544:Ace	UTSW	11	105971290	critical splice acceptor site	probably null
R8695:Ace	UTSW	11	105985145	missense	probably benign	0.00
R8731:Ace	UTSW	11	105970600	missense	possibly damaging	0.93
R8855:Ace	UTSW	11	105970598	nonsense	probably null
R9087:Ace	UTSW	11	105981919	missense	probably damaging	1.00
R9149:Ace	UTSW	11	105972473	missense	possibly damaging	0.57
R9347:Ace	UTSW	11	105974132	missense	probably damaging	1.00
R9590:Ace	UTSW	11	105985680	missense	probably benign	0.01
X0018:Ace	UTSW	11	105971384	missense	probably damaging	1.00
X0063:Ace	UTSW	11	105975638	missense	probably benign	0.07
Z1177:Ace	UTSW	11	105988134	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAGTGATCTGCTGTGGTC -3'
(R):5'- CTTGGCATAGACCAATCCCC -3'

Sequencing Primer
(F):5'- CAGTAGTGCCCTGCCTTTGG -3'
(R):5'- AGAGGCAGGTCTGTGTCAC -3'

Posted On

2019-12-20