Incidental Mutation 'R7855:Pecam1'
ID607199
Institutional Source Beutler Lab
Gene Symbol Pecam1
Ensembl Gene ENSMUSG00000020717
Gene Nameplatelet/endothelial cell adhesion molecule 1
SynonymsCd31, PECAM-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R7855 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106654217-106750628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106671750 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 708 (V708A)
Ref Sequence ENSEMBL: ENSMUSP00000079664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068021] [ENSMUST00000080853] [ENSMUST00000103069] [ENSMUST00000106796] [ENSMUST00000183610]
Predicted Effect probably benign
Transcript: ENSMUST00000068021
AA Change: V708A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067111
Gene: ENSMUSG00000020717
AA Change: V708A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
Pfam:Ig_3 122 198 4.2e-4 PFAM
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 718 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080853
AA Change: V708A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079664
Gene: ENSMUSG00000020717
AA Change: V708A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 710 4e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000103069
SMART Domains Protein: ENSMUSP00000099358
Gene: ENSMUSG00000020717

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106796
AA Change: V708A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102408
Gene: ENSMUSG00000020717
AA Change: V708A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 727 1e-16 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000183610
AA Change: V607A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138959
Gene: ENSMUSG00000020717
AA Change: V607A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 129 210 1.38e2 SMART
IG_like 226 281 2e-1 SMART
Blast:IG_like 304 385 2e-31 BLAST
IG 396 483 5.49e-1 SMART
transmembrane domain 491 513 N/A INTRINSIC
PDB:2KY5|A 575 626 1e-16 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found on the surface of platelets, monocytes, neutrophils, and some types of T-cells, and makes up a large portion of endothelial cell intercellular junctions. The encoded protein is a member of the immunoglobulin superfamily and is likely involved in leukocyte migration, angiogenesis, and integrin activation. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show increased susceptibility to collagen-induced arthritis, impaired lung alveolarization, and enhanced susceptibility to endotoxic shock. Mice homozygous for a gene-trapped allele show altered vasodilation and nitric oxide homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Pecam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Pecam1 APN 11 106699798 missense probably damaging 1.00
IGL01914:Pecam1 APN 11 106699867 missense possibly damaging 0.95
IGL02035:Pecam1 APN 11 106695859 missense probably benign 0.43
IGL02124:Pecam1 APN 11 106690981 missense probably damaging 0.98
IGL02487:Pecam1 APN 11 106671780 missense probably damaging 1.00
IGL02576:Pecam1 APN 11 106671774 missense probably damaging 1.00
IGL03101:Pecam1 APN 11 106697351 missense probably damaging 0.99
R1495:Pecam1 UTSW 11 106688856 missense probably damaging 0.96
R1614:Pecam1 UTSW 11 106681079 missense probably benign 0.00
R1628:Pecam1 UTSW 11 106682960 splice site probably null
R1950:Pecam1 UTSW 11 106685203 missense probably damaging 1.00
R1994:Pecam1 UTSW 11 106695937 missense possibly damaging 0.95
R3149:Pecam1 UTSW 11 106684281 missense possibly damaging 0.53
R4022:Pecam1 UTSW 11 106655160 missense probably benign 0.00
R4418:Pecam1 UTSW 11 106695922 missense possibly damaging 0.61
R4747:Pecam1 UTSW 11 106684246 missense probably benign 0.29
R4828:Pecam1 UTSW 11 106699808 missense probably damaging 1.00
R5798:Pecam1 UTSW 11 106695832 missense possibly damaging 0.95
R5864:Pecam1 UTSW 11 106684250 nonsense probably null
R5942:Pecam1 UTSW 11 106661983 intron probably benign
R5966:Pecam1 UTSW 11 106691061 missense probably benign 0.44
R6285:Pecam1 UTSW 11 106685239 missense probably benign 0.02
R6519:Pecam1 UTSW 11 106699642 missense probably benign 0.01
R7078:Pecam1 UTSW 11 106688947 missense probably benign 0.06
R7135:Pecam1 UTSW 11 106689031 missense probably damaging 0.99
R7215:Pecam1 UTSW 11 106695919 missense probably benign 0.15
R7574:Pecam1 UTSW 11 106699784 missense probably damaging 1.00
R7795:Pecam1 UTSW 11 106695832 nonsense probably null
R7938:Pecam1 UTSW 11 106671750 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGCTCAGAGATGTGCTTC -3'
(R):5'- GAACTTCTGAAGCTGGGGAATG -3'

Sequencing Primer
(F):5'- GGAAGTGATGTCCCACACCTTTAATC -3'
(R):5'- GCTGGGGAATGATGATATACTCG -3'
Posted On2019-12-20