Incidental Mutation 'R7855:Brms1l'
ID 607202
Institutional Source Beutler Lab
Gene Symbol Brms1l
Ensembl Gene ENSMUSG00000012076
Gene Name breast cancer metastasis-suppressor 1-like
Synonyms 0710008O11Rik, D12Ertd407e, BRMS1
MMRRC Submission 045908-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.939) question?
Stock # R7855 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 55883109-55916521 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55912838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 277 (D277V)
Ref Sequence ENSEMBL: ENSMUSP00000082500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059250] [ENSMUST00000219419]
AlphaFold Q3U1T3
Predicted Effect possibly damaging
Transcript: ENSMUST00000059250
AA Change: D277V

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082500
Gene: ENSMUSG00000012076
AA Change: D277V

DomainStartEndE-ValueType
low complexity region 24 55 N/A INTRINSIC
Pfam:Sds3 61 217 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219419
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shows sequence similarity to the human breast carcinoma metastasis suppressor (BRMS1) protein and the mammalian Sds3 (suppressor of defective silencing 3) proteins. This protein is a component of the mSin3a family of histone deacetylase complexes (HDAC). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,082,454 (GRCm39) V1173D probably benign Het
Ace A T 11: 105,863,205 (GRCm39) M327L probably benign Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bicdl2 C T 17: 23,884,991 (GRCm39) Q231* probably null Het
Cd38 C A 5: 44,058,790 (GRCm39) L135M probably damaging Het
Col6a3 G T 1: 90,738,343 (GRCm39) P1059T possibly damaging Het
Coro1c A T 5: 113,986,658 (GRCm39) M262K probably benign Het
Cpxm2 G T 7: 131,659,424 (GRCm39) P481Q possibly damaging Het
Dipk1c G A 18: 84,748,171 (GRCm39) probably benign Het
Dnah12 G T 14: 26,551,286 (GRCm39) V2543F probably benign Het
Dock2 A C 11: 34,223,698 (GRCm39) D1145E probably damaging Het
Elf3 G A 1: 135,182,090 (GRCm39) R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,739,935 (GRCm39) probably benign Het
Epha3 A G 16: 63,593,923 (GRCm39) I55T probably damaging Het
Gfer C A 17: 24,913,259 (GRCm39) D198Y probably damaging Het
Gm11568 A T 11: 99,749,010 (GRCm39) T72S unknown Het
Igkv3-1 C T 6: 70,681,053 (GRCm39) A84V probably benign Het
Il1rl2 A C 1: 40,382,279 (GRCm39) Y197S probably damaging Het
Il2ra T C 2: 11,685,147 (GRCm39) I161T possibly damaging Het
Itgb8 C T 12: 119,130,507 (GRCm39) R667H probably benign Het
Kcnh7 G A 2: 62,667,538 (GRCm39) Q334* probably null Het
Lctl A C 9: 64,040,498 (GRCm39) R480S possibly damaging Het
Lrba T G 3: 86,222,737 (GRCm39) I617S possibly damaging Het
Marf1 G T 16: 13,932,065 (GRCm39) H1651N probably benign Het
Mitf T A 6: 97,970,157 (GRCm39) Y142N probably damaging Het
Or51v14 T A 7: 103,260,979 (GRCm39) I194F possibly damaging Het
Or52r1 A G 7: 102,536,835 (GRCm39) V175A probably benign Het
Pecam1 A G 11: 106,562,576 (GRCm39) V708A probably benign Het
Pinlyp C T 7: 24,241,865 (GRCm39) probably null Het
Polh G A 17: 46,486,174 (GRCm39) R382W probably damaging Het
Pramel51 A T 12: 88,142,853 (GRCm39) I450N probably benign Het
Prdm10 A G 9: 31,238,770 (GRCm39) I221V probably benign Het
Pskh1 G T 8: 106,639,722 (GRCm39) R134L probably benign Het
Ptpre A G 7: 135,253,724 (GRCm39) N6D probably benign Het
Rasgrp4 C T 7: 28,850,035 (GRCm39) P58L unknown Het
Rhbdf2 G T 11: 116,493,066 (GRCm39) C393* probably null Het
Rlf T C 4: 121,039,888 (GRCm39) I174M possibly damaging Het
Ryr2 T A 13: 11,721,509 (GRCm39) R2641* probably null Het
Semp2l1 A C 1: 32,585,114 (GRCm39) I265M probably damaging Het
Simc1 A G 13: 54,672,645 (GRCm39) H331R probably benign Het
Skp2 A G 15: 9,122,328 (GRCm39) S256P probably benign Het
Smarcd2 T C 11: 106,158,392 (GRCm39) R10G probably benign Het
Spef2 A G 15: 9,687,981 (GRCm39) L480P possibly damaging Het
Tenm4 A G 7: 96,523,081 (GRCm39) H1541R probably damaging Het
Top1 T A 2: 160,556,008 (GRCm39) L489Q probably damaging Het
Ttll13 C T 7: 79,903,845 (GRCm39) H258Y probably damaging Het
Unc80 A G 1: 66,522,508 (GRCm39) R237G possibly damaging Het
Vmn1r55 A G 7: 5,149,623 (GRCm39) F267L probably benign Het
Vmn2r96 T A 17: 18,818,130 (GRCm39) M761K possibly damaging Het
Vps33a G A 5: 123,709,042 (GRCm39) H58Y possibly damaging Het
Zfp1002 C T 2: 150,097,066 (GRCm39) R121Q probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp467 T C 6: 48,416,115 (GRCm39) Q179R probably damaging Het
Zfp729a A T 13: 67,768,067 (GRCm39) S721T possibly damaging Het
Zfta T A 19: 7,399,621 (GRCm39) I456N probably damaging Het
Other mutations in Brms1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Brms1l APN 12 55,892,111 (GRCm39) missense probably benign 0.15
IGL00951:Brms1l APN 12 55,912,834 (GRCm39) missense possibly damaging 0.54
IGL02199:Brms1l APN 12 55,907,957 (GRCm39) critical splice donor site probably benign
IGL02669:Brms1l APN 12 55,888,401 (GRCm39) missense probably damaging 1.00
IGL03158:Brms1l APN 12 55,883,320 (GRCm39) missense possibly damaging 0.83
IGL03184:Brms1l APN 12 55,915,062 (GRCm39) makesense probably null
R0445:Brms1l UTSW 12 55,908,191 (GRCm39) nonsense probably null
R0568:Brms1l UTSW 12 55,908,173 (GRCm39) critical splice acceptor site probably null
R0942:Brms1l UTSW 12 55,912,742 (GRCm39) missense probably benign 0.00
R0968:Brms1l UTSW 12 55,912,798 (GRCm39) missense possibly damaging 0.73
R1240:Brms1l UTSW 12 55,891,293 (GRCm39) missense probably damaging 1.00
R1580:Brms1l UTSW 12 55,915,007 (GRCm39) missense probably damaging 1.00
R1694:Brms1l UTSW 12 55,888,385 (GRCm39) missense probably damaging 1.00
R1926:Brms1l UTSW 12 55,909,946 (GRCm39) missense possibly damaging 0.69
R4626:Brms1l UTSW 12 55,909,958 (GRCm39) missense probably benign 0.01
R4669:Brms1l UTSW 12 55,888,356 (GRCm39) missense possibly damaging 0.83
R4987:Brms1l UTSW 12 55,912,800 (GRCm39) missense probably benign 0.15
R6010:Brms1l UTSW 12 55,914,985 (GRCm39) missense possibly damaging 0.55
R6129:Brms1l UTSW 12 55,914,970 (GRCm39) missense probably benign 0.03
R7429:Brms1l UTSW 12 55,892,084 (GRCm39) missense probably damaging 1.00
R7430:Brms1l UTSW 12 55,892,084 (GRCm39) missense probably damaging 1.00
R7510:Brms1l UTSW 12 55,892,107 (GRCm39) nonsense probably null
R7543:Brms1l UTSW 12 55,914,997 (GRCm39) missense probably damaging 1.00
R8200:Brms1l UTSW 12 55,891,183 (GRCm39) missense probably damaging 1.00
R8376:Brms1l UTSW 12 55,888,414 (GRCm39) missense probably benign 0.03
R8532:Brms1l UTSW 12 55,891,264 (GRCm39) missense probably damaging 1.00
R9131:Brms1l UTSW 12 55,906,913 (GRCm39) missense possibly damaging 0.93
R9335:Brms1l UTSW 12 55,888,431 (GRCm39) missense possibly damaging 0.96
R9433:Brms1l UTSW 12 55,912,863 (GRCm39) critical splice donor site probably null
R9577:Brms1l UTSW 12 55,906,876 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATCACCCATGTGCTTGC -3'
(R):5'- GTGCACCCATGATTGGATCTTAC -3'

Sequencing Primer
(F):5'- GCATATATGTGCATGCATTACTGTTG -3'
(R):5'- GCACCCATGATTGGATCTTACTCAAG -3'
Posted On 2019-12-20