Mutagenetix > Incidental Mutation

Incidental Mutation 'R7855:Itgb8'

607204

Institutional Source

Beutler Lab

Gene Symbol

Itgb8

Ensembl Gene

ENSMUSG00000025321

Gene Name

integrin beta 8

Synonyms

4832412O06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7855 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119158022-119238802 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119166772 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 667 (R667H)

Ref Sequence

ENSEMBL: ENSMUSP00000026360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026360]

AlphaFold

Q0VBD0

Predicted Effect

probably benign
Transcript: ENSMUST00000026360
AA Change: R667H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026360
Gene: ENSMUSG00000025321
AA Change: R667H

Domain	Start	End	E-Value	Type
Blast:INB	1	44	9e-8	BLAST
PSI	46	95	6.65e-9	SMART
INB	54	469	4.31e-237	SMART
VWA	146	352	2.15e-1	SMART
Blast:INB	494	532	9e-12	BLAST
EGF	551	583	1.53e1	SMART
transmembrane domain	680	702	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the integrin beta chain family and encodes a single-pass type I membrane protein with a VWFA domain and four cysteine-rich repeats. This protein noncovalently binds to an alpha subunit to form a heterodimeric integrin complex. In general, integrin complexes mediate cell-cell and cell-extracellular matrix interactions and this complex plays a role in human airway epithelial proliferation. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene either die before E11.5 as a result of circulatory abnormalities in the placenta or die within the first for days after birth and display intracerebral hemorrhaging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	A	19: 7,422,256	I456N	probably damaging	Het
Abca6	A	T	11: 110,191,628	V1173D	probably benign	Het
Ace	A	T	11: 105,972,379	M327L	probably benign	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicdl2	C	T	17: 23,666,017	Q231*	probably null	Het
Brms1l	A	T	12: 55,866,053	D277V	possibly damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Col6a3	G	T	1: 90,810,621	P1059T	possibly damaging	Het
Coro1c	A	T	5: 113,848,597	M262K	probably benign	Het
Cpxm2	G	T	7: 132,057,695	P481Q	possibly damaging	Het
Dnah12	G	T	14: 26,829,329	V2543F	probably benign	Het
Dock2	A	C	11: 34,273,698	D1145E	probably damaging	Het
Elf3	G	A	1: 135,254,352	R364W	probably damaging	Het
Eln	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	5: 134,711,081		probably benign	Het
Epha3	A	G	16: 63,773,560	I55T	probably damaging	Het
Fam69c	G	A	18: 84,730,046		probably benign	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Gm10436	A	T	12: 88,176,083	I450N	probably benign	Het
Gm11568	A	T	11: 99,858,184	T72S	unknown	Het
Gm21994	C	T	2: 150,255,146	R121Q	probably benign	Het
Gm5415	A	C	1: 32,546,033	I265M	probably damaging	Het
Igkv3-1	C	T	6: 70,704,069	A84V	probably benign	Het
Il1rl2	A	C	1: 40,343,119	Y197S	probably damaging	Het
Il2ra	T	C	2: 11,680,336	I161T	possibly damaging	Het
Kcnh7	G	A	2: 62,837,194	Q334*	probably null	Het
Lctl	A	C	9: 64,133,216	R480S	possibly damaging	Het
Lrba	T	G	3: 86,315,430	I617S	possibly damaging	Het
Marf1	G	T	16: 14,114,201	H1651N	probably benign	Het
Mitf	T	A	6: 97,993,196	Y142N	probably damaging	Het
Olfr569	A	G	7: 102,887,628	V175A	probably benign	Het
Olfr620	T	A	7: 103,611,772	I194F	possibly damaging	Het
Pecam1	A	G	11: 106,671,750	V708A	probably benign	Het
Pinlyp	C	T	7: 24,542,440		probably null	Het
Polh	G	A	17: 46,175,248	R382W	probably damaging	Het
Prdm10	A	G	9: 31,327,474	I221V	probably benign	Het
Pskh1	G	T	8: 105,913,090	R134L	probably benign	Het
Ptpre	A	G	7: 135,651,995	N6D	probably benign	Het
Rasgrp4	C	T	7: 29,150,610	P58L	unknown	Het
Rhbdf2	G	T	11: 116,602,240	C393*	probably null	Het
Rlf	T	C	4: 121,182,691	I174M	possibly damaging	Het
Ryr2	T	A	13: 11,706,623	R2641*	probably null	Het
Simc1	A	G	13: 54,524,832	H331R	probably benign	Het
Skp2	A	G	15: 9,122,241	S256P	probably benign	Het
Smarcd2	T	C	11: 106,267,566	R10G	probably benign	Het
Spef2	A	G	15: 9,687,895	L480P	possibly damaging	Het
Tenm4	A	G	7: 96,873,874	H1541R	probably damaging	Het
Top1	T	A	2: 160,714,088	L489Q	probably damaging	Het
Ttll13	C	T	7: 80,254,097	H258Y	probably damaging	Het
Unc80	A	G	1: 66,483,349	R237G	possibly damaging	Het
Vmn1r55	A	G	7: 5,146,624	F267L	probably benign	Het
Vmn2r96	T	A	17: 18,597,868	M761K	possibly damaging	Het
Vps33a	G	A	5: 123,570,979	H58Y	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp467	T	C	6: 48,439,181	Q179R	probably damaging	Het
Zfp729a	A	T	13: 67,619,948	S721T	possibly damaging	Het

Other mutations in Itgb8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Itgb8	APN	12	119189826	missense	probably damaging	0.99
IGL01859:Itgb8	APN	12	119189945	missense	probably damaging	1.00
IGL02555:Itgb8	APN	12	119189881	missense	probably damaging	1.00
IGL02665:Itgb8	APN	12	119166865	splice site	probably benign
IGL02732:Itgb8	APN	12	119163353	missense	probably benign	0.09
R0090:Itgb8	UTSW	12	119202563	missense	probably benign	0.00
R0245:Itgb8	UTSW	12	119190555	missense	probably damaging	1.00
R0629:Itgb8	UTSW	12	119202481	missense	probably benign	0.38
R1158:Itgb8	UTSW	12	119202496	missense	probably damaging	1.00
R1355:Itgb8	UTSW	12	119171003	missense	probably benign	0.03
R1370:Itgb8	UTSW	12	119171003	missense	probably benign	0.03
R1604:Itgb8	UTSW	12	119202530	missense	probably damaging	1.00
R1689:Itgb8	UTSW	12	119170820	missense	probably benign	0.38
R1782:Itgb8	UTSW	12	119192118	missense	probably damaging	0.99
R1789:Itgb8	UTSW	12	119202455	missense	probably benign
R2113:Itgb8	UTSW	12	119190612	missense	probably damaging	1.00
R2301:Itgb8	UTSW	12	119202455	missense	probably benign
R3696:Itgb8	UTSW	12	119177011	missense	probably damaging	0.99
R3797:Itgb8	UTSW	12	119163469	missense	possibly damaging	0.92
R3911:Itgb8	UTSW	12	119168005	missense	possibly damaging	0.65
R4904:Itgb8	UTSW	12	119170871	missense	probably benign	0.00
R5391:Itgb8	UTSW	12	119170741	missense	probably damaging	1.00
R5395:Itgb8	UTSW	12	119170741	missense	probably damaging	1.00
R5444:Itgb8	UTSW	12	119237838	utr 5 prime	probably benign
R5461:Itgb8	UTSW	12	119168005	missense	probably benign	0.28
R5610:Itgb8	UTSW	12	119170694	missense	probably damaging	1.00
R5669:Itgb8	UTSW	12	119190628	missense	probably damaging	1.00
R5877:Itgb8	UTSW	12	119202536	missense	probably benign	0.37
R6581:Itgb8	UTSW	12	119163215	missense	probably benign	0.41
R6597:Itgb8	UTSW	12	119173398	missense	possibly damaging	0.94
R6631:Itgb8	UTSW	12	119180977	nonsense	probably null
R6971:Itgb8	UTSW	12	119190631	missense	probably damaging	1.00
R7124:Itgb8	UTSW	12	119202424	nonsense	probably null
R7246:Itgb8	UTSW	12	119168050	missense	probably damaging	1.00
R7282:Itgb8	UTSW	12	119237708	missense	probably benign	0.00
R7299:Itgb8	UTSW	12	119202461	missense	probably benign	0.00
R7340:Itgb8	UTSW	12	119192204	missense	probably benign	0.45
R7373:Itgb8	UTSW	12	119202475	missense	probably benign	0.01
R7766:Itgb8	UTSW	12	119163359	missense	probably damaging	1.00
R8195:Itgb8	UTSW	12	119168170	missense	probably damaging	1.00
R8354:Itgb8	UTSW	12	119170778	missense	probably benign	0.01
R8454:Itgb8	UTSW	12	119170778	missense	probably benign	0.01
R9151:Itgb8	UTSW	12	119166800	missense	probably benign	0.30
R9583:Itgb8	UTSW	12	119189973	missense	possibly damaging	0.91
R9588:Itgb8	UTSW	12	119177019	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACCACCTAAGTATTTCTCTTTGGG -3'
(R):5'- TTGAGTTGAACTGTGCAAGTAC -3'

Sequencing Primer
(F):5'- ACAGGGTGTGTTTTTGTTTCTGTTTC -3'
(R):5'- ACTCTGTAGATCAGGCATTCCTAGG -3'

Posted On

2019-12-20