Incidental Mutation 'R7855:Bicdl2'
ID607215
Institutional Source Beutler Lab
Gene Symbol Bicdl2
Ensembl Gene ENSMUSG00000043782
Gene NameBICD family like cargo adaptor 2
SynonymsCcdc64b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7855 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23660523-23668610 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 23666017 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 231 (Q231*)
Ref Sequence ENSEMBL: ENSMUSP00000053808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047436] [ENSMUST00000062967] [ENSMUST00000095579] [ENSMUST00000115489] [ENSMUST00000115490] [ENSMUST00000138190]
Predicted Effect probably benign
Transcript: ENSMUST00000047436
SMART Domains Protein: ENSMUSP00000038137
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 2e-18 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 1e-11 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 2e-25 BLAST
WD40 248 284 7.36e1 SMART
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000062967
AA Change: Q231*
SMART Domains Protein: ENSMUSP00000053808
Gene: ENSMUSG00000043782
AA Change: Q231*

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
coiled coil region 63 293 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
coiled coil region 354 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095579
SMART Domains Protein: ENSMUSP00000093239
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 2e-18 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 1e-11 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 2e-25 BLAST
WD40 248 284 7.36e1 SMART
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115489
SMART Domains Protein: ENSMUSP00000111152
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 11 47 6e-18 BLAST
WD40 61 97 2.67e-1 SMART
Blast:WD40 115 150 8e-12 BLAST
WD40 153 192 1.28e-6 SMART
Blast:WD40 196 241 3e-25 BLAST
WD40 244 280 7.36e1 SMART
low complexity region 290 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115490
SMART Domains Protein: ENSMUSP00000111153
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 7e-19 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 6e-12 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 8e-26 BLAST
Blast:WD40 248 279 4e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135259
SMART Domains Protein: ENSMUSP00000119920
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 32 67 9e-13 BLAST
WD40 70 109 1.28e-6 SMART
Blast:WD40 113 186 4e-20 BLAST
Blast:WD40 189 209 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138190
SMART Domains Protein: ENSMUSP00000123075
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 6e-20 BLAST
WD40 65 101 2.67e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Bicdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Bicdl2 APN 17 23668131 missense probably damaging 1.00
IGL03283:Bicdl2 APN 17 23667181 missense probably damaging 1.00
R1013:Bicdl2 UTSW 17 23665403 unclassified probably benign
R1351:Bicdl2 UTSW 17 23667545 unclassified probably benign
R1512:Bicdl2 UTSW 17 23668109 missense probably damaging 0.96
R1768:Bicdl2 UTSW 17 23665949 missense probably damaging 1.00
R2886:Bicdl2 UTSW 17 23666758 unclassified probably null
R4154:Bicdl2 UTSW 17 23666092 splice site probably null
R4440:Bicdl2 UTSW 17 23667616 missense probably benign 0.17
R5133:Bicdl2 UTSW 17 23661821 missense unknown
R5358:Bicdl2 UTSW 17 23667564 missense probably benign 0.00
R6759:Bicdl2 UTSW 17 23666744 splice site probably null
R7938:Bicdl2 UTSW 17 23666017 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGGATGGCTCCATTGTCAG -3'
(R):5'- AAAAGTGCCTGTCCTTTGTTC -3'

Sequencing Primer
(F):5'- AGCGGTGTCAGACTCAGG -3'
(R):5'- AAAAGTGCCTGTCCTTTGTTCTATAC -3'
Posted On2019-12-20