Incidental Mutation 'R7855:Polh'
ID607217
Institutional Source Beutler Lab
Gene Symbol Polh
Ensembl Gene ENSMUSG00000023953
Gene Namepolymerase (DNA directed), eta (RAD 30 related)
SynonymsRAD30A
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R7855 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46172004-46202625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46175248 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 382 (R382W)
Ref Sequence ENSEMBL: ENSMUSP00000024749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024749]
Predicted Effect probably damaging
Transcript: ENSMUST00000024749
AA Change: R382W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024749
Gene: ENSMUSG00000023953
AA Change: R382W

DomainStartEndE-ValueType
Pfam:IMS 12 227 9.7e-53 PFAM
Pfam:IMS_C 308 435 5.8e-15 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 540 561 N/A INTRINSIC
PDB:2I5O|A 606 643 7e-15 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Y family of specialized DNA polymerases. It copies undamaged DNA with a lower fidelity than other DNA-directed polymerases. However, it accurately replicates UV-damaged DNA; when thymine dimers are present, this polymerase inserts the complementary nucleotides in the newly synthesized DNA, thereby bypassing the lesion and suppressing the mutagenic effect of UV-induced DNA damage. This polymerase is thought to be involved in hypermutation during immunoglobulin class switch recombination. Mutations in this gene result in XPV, a variant type of xeroderma pigmentosum. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous inactivation of this gene causes increased susceptibility to UV-induced skin tumors and results in reduced immunoglobulin gene mutations at A-T base pairs with a G-C biased mutation pattern. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T A 19: 7,422,256 I456N probably damaging Het
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in Polh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Polh APN 17 46172243 unclassified probably benign
IGL00585:Polh APN 17 46172243 unclassified probably benign
IGL01812:Polh APN 17 46172911 missense probably benign 0.04
IGL01996:Polh APN 17 46173001 missense probably benign 0.00
IGL02578:Polh APN 17 46194292 nonsense probably null
IGL02829:Polh APN 17 46172902 missense possibly damaging 0.82
IGL03003:Polh APN 17 46194366 missense possibly damaging 0.57
R1435:Polh UTSW 17 46194255 missense probably damaging 1.00
R2091:Polh UTSW 17 46181454 splice site probably benign
R2129:Polh UTSW 17 46188088 nonsense probably null
R4226:Polh UTSW 17 46172594 missense probably benign
R4227:Polh UTSW 17 46172594 missense probably benign
R5483:Polh UTSW 17 46172745 missense probably benign 0.01
R5878:Polh UTSW 17 46194325 missense probably damaging 0.99
R6039:Polh UTSW 17 46188033 missense probably benign 0.00
R6039:Polh UTSW 17 46188033 missense probably benign 0.00
R6177:Polh UTSW 17 46184744 missense possibly damaging 0.94
R6345:Polh UTSW 17 46182738 missense probably benign 0.03
R6545:Polh UTSW 17 46182759 missense possibly damaging 0.74
R6712:Polh UTSW 17 46190729 missense probably benign 0.12
R7054:Polh UTSW 17 46198716 missense probably benign 0.24
R7708:Polh UTSW 17 46172700 missense probably benign 0.00
R7938:Polh UTSW 17 46175248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAAAATAAGAGTCTCACCACTT -3'
(R):5'- AGGCTCTACCCCTTATAATGCT -3'

Sequencing Primer
(F):5'- ATAAGAGTCTCACCACTTGGGCTG -3'
(R):5'- ATAGGATCTTACAGTGCAGCCCTG -3'
Posted On2019-12-20