Incidental Mutation 'R7856:Ccdc34'
ID607223
Institutional Source Beutler Lab
Gene Symbol Ccdc34
Ensembl Gene ENSMUSG00000027160
Gene Namecoiled-coil domain containing 34
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7856 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location110017817-110173360 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 110044227 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 310 (Y310*)
Ref Sequence ENSEMBL: ENSMUSP00000028580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028580]
Predicted Effect probably null
Transcript: ENSMUST00000028580
AA Change: Y310*
SMART Domains Protein: ENSMUSP00000028580
Gene: ENSMUSG00000027160
AA Change: Y310*

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Pfam:DUF4207 62 315 5.6e-56 PFAM
low complexity region 338 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127630
SMART Domains Protein: ENSMUSP00000130554
Gene: ENSMUSG00000027160

DomainStartEndE-ValueType
Pfam:DUF4207 25 174 6.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150183
SMART Domains Protein: ENSMUSP00000127363
Gene: ENSMUSG00000027160

DomainStartEndE-ValueType
Pfam:DUF4207 31 139 3.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Dusp7 C A 9: 106,368,868 A24E unknown Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Ccdc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
LCD18:Ccdc34 UTSW 2 110016318 unclassified probably benign
R1808:Ccdc34 UTSW 2 110044256 missense probably benign 0.15
R2011:Ccdc34 UTSW 2 110044304 missense possibly damaging 0.93
R2025:Ccdc34 UTSW 2 110032386 missense possibly damaging 0.95
R3852:Ccdc34 UTSW 2 110032428 missense possibly damaging 0.95
R4968:Ccdc34 UTSW 2 110040733 critical splice donor site probably null
R4986:Ccdc34 UTSW 2 110017869 start codon destroyed probably null 0.02
R6075:Ccdc34 UTSW 2 110044235 missense possibly damaging 0.77
R6103:Ccdc34 UTSW 2 110018007 missense probably benign 0.04
R6294:Ccdc34 UTSW 2 110018151 missense probably benign 0.08
R7939:Ccdc34 UTSW 2 110044227 nonsense probably null
X0025:Ccdc34 UTSW 2 110044312 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGCCTCAAGTTTTAAGCTATCC -3'
(R):5'- TAAATGTAAGCTCCGGGTAGCTAG -3'

Sequencing Primer
(F):5'- CAATTTATCAGTGATATTTTGTCGCC -3'
(R):5'- CTCCGGGTAGCTAGGTATGCTC -3'
Posted On2019-12-20