Incidental Mutation 'R7856:Zfp937'
ID607224
Institutional Source Beutler Lab
Gene Symbol Zfp937
Ensembl Gene ENSMUSG00000060336
Gene Namezinc finger protein 937
SynonymsGm4979
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R7856 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location150218073-150240725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150239547 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 499 (V499A)
Ref Sequence ENSEMBL: ENSMUSP00000073454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073782]
Predicted Effect probably benign
Transcript: ENSMUST00000073782
AA Change: V499A

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073454
Gene: ENSMUSG00000060336
AA Change: V499A

DomainStartEndE-ValueType
KRAB 4 66 8.19e-20 SMART
ZnF_C2H2 103 125 1.28e-3 SMART
ZnF_C2H2 131 153 2.53e-2 SMART
ZnF_C2H2 159 181 9.58e-3 SMART
ZnF_C2H2 187 209 2.09e-3 SMART
ZnF_C2H2 215 237 2.2e-2 SMART
ZnF_C2H2 243 265 2.2e-2 SMART
ZnF_C2H2 271 293 2.2e-2 SMART
ZnF_C2H2 299 321 1.82e-3 SMART
ZnF_C2H2 327 349 3.69e-4 SMART
ZnF_C2H2 355 377 4.47e-3 SMART
ZnF_C2H2 383 405 3.89e-3 SMART
ZnF_C2H2 411 433 4.79e-3 SMART
ZnF_C2H2 439 461 8.47e-4 SMART
ZnF_C2H2 467 490 7.26e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Dusp7 C A 9: 106,368,868 A24E unknown Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Other mutations in Zfp937
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0350:Zfp937 UTSW 2 150239302 missense possibly damaging 0.91
R0449:Zfp937 UTSW 2 150239546 missense probably benign 0.13
R1403:Zfp937 UTSW 2 150238948 nonsense probably null
R1403:Zfp937 UTSW 2 150238948 nonsense probably null
R1465:Zfp937 UTSW 2 150239047 nonsense probably null
R1465:Zfp937 UTSW 2 150239047 nonsense probably null
R4510:Zfp937 UTSW 2 150238511 missense probably damaging 0.98
R4511:Zfp937 UTSW 2 150238511 missense probably damaging 0.98
R4689:Zfp937 UTSW 2 150236786 missense probably damaging 1.00
R5290:Zfp937 UTSW 2 150238309 nonsense probably null
R6287:Zfp937 UTSW 2 150238341 missense possibly damaging 0.89
R6701:Zfp937 UTSW 2 150239216 missense probably damaging 1.00
R6746:Zfp937 UTSW 2 150239423 nonsense probably null
R6838:Zfp937 UTSW 2 150239346 missense probably benign 0.01
R7162:Zfp937 UTSW 2 150239519 missense probably benign 0.35
R7213:Zfp937 UTSW 2 150239465 missense probably damaging 1.00
R7441:Zfp937 UTSW 2 150238710 frame shift probably null
R7481:Zfp937 UTSW 2 150239346 missense probably benign 0.01
R7694:Zfp937 UTSW 2 150239348 missense probably damaging 1.00
R7902:Zfp937 UTSW 2 150238761 missense probably damaging 1.00
R8058:Zfp937 UTSW 2 150239501 missense probably benign 0.00
X0017:Zfp937 UTSW 2 150218161 utr 5 prime probably null
Predicted Primers PCR Primer
(F):5'- CATACTGGACAGAAAGCCTATGG -3'
(R):5'- GGCTTGTAAAATGTGAAAAGGCTTG -3'

Sequencing Primer
(F):5'- CCTATGGATGCAAGCAATGTGGC -3'
(R):5'- AAAGGCTTGATCTGATGTAGTGTAC -3'
Posted On2019-12-20