Incidental Mutation 'R7856:Ccdc63'
ID607232
Institutional Source Beutler Lab
Gene Symbol Ccdc63
Ensembl Gene ENSMUSG00000043036
Gene Namecoiled-coil domain containing 63
Synonyms4921511C16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7856 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122108040-122140823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122129943 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 8 (W8R)
Ref Sequence ENSEMBL: ENSMUSP00000050582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058960] [ENSMUST00000128101] [ENSMUST00000132701] [ENSMUST00000152389]
Predicted Effect probably benign
Transcript: ENSMUST00000058960
AA Change: W8R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050582
Gene: ENSMUSG00000043036
AA Change: W8R

DomainStartEndE-ValueType
coiled coil region 140 158 N/A INTRINSIC
coiled coil region 209 285 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
coiled coil region 393 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128101
Predicted Effect probably benign
Transcript: ENSMUST00000132701
AA Change: W8R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000152389
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T C 3: 138,286,912 V263A probably damaging Het
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Dusp7 C A 9: 106,368,868 A24E unknown Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Fcgr1 A T 3: 96,284,627 probably null Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Krtcap3 T A 5: 31,251,946 M19K probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Reg1 T C 6: 78,427,361 S73P probably damaging Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Ccdc63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Ccdc63 APN 5 122124919 splice site probably benign
IGL01660:Ccdc63 APN 5 122110964 missense possibly damaging 0.81
IGL01773:Ccdc63 APN 5 122113145 missense possibly damaging 0.93
IGL02341:Ccdc63 APN 5 122113198 missense probably benign 0.00
IGL03030:Ccdc63 APN 5 122122813 missense probably benign 0.00
IGL02991:Ccdc63 UTSW 5 122108212 missense probably benign 0.10
R0267:Ccdc63 UTSW 5 122117044 splice site probably benign
R0961:Ccdc63 UTSW 5 122110946 missense possibly damaging 0.75
R1333:Ccdc63 UTSW 5 122108161 missense probably benign 0.04
R1802:Ccdc63 UTSW 5 122129877 missense probably damaging 1.00
R1999:Ccdc63 UTSW 5 122127565 missense possibly damaging 0.72
R2048:Ccdc63 UTSW 5 122130287 critical splice donor site probably null
R2150:Ccdc63 UTSW 5 122127565 missense possibly damaging 0.72
R2350:Ccdc63 UTSW 5 122122885 missense probably benign 0.04
R4049:Ccdc63 UTSW 5 122122750 missense probably damaging 0.99
R5072:Ccdc63 UTSW 5 122121055 missense probably benign 0.28
R5847:Ccdc63 UTSW 5 122116845 missense possibly damaging 0.78
R6031:Ccdc63 UTSW 5 122129736 missense possibly damaging 0.74
R6031:Ccdc63 UTSW 5 122129736 missense possibly damaging 0.74
R6249:Ccdc63 UTSW 5 122124999 missense probably benign 0.17
R6782:Ccdc63 UTSW 5 122111014 nonsense probably null
R7073:Ccdc63 UTSW 5 122111010 missense probably benign 0.00
R7250:Ccdc63 UTSW 5 122122843 missense probably damaging 1.00
R7448:Ccdc63 UTSW 5 122108182 missense probably benign 0.00
R7584:Ccdc63 UTSW 5 122113204 missense possibly damaging 0.73
R7773:Ccdc63 UTSW 5 122109272 missense probably damaging 1.00
R7939:Ccdc63 UTSW 5 122129943 missense probably benign 0.00
X0028:Ccdc63 UTSW 5 122109175 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GGACACCCCTCTTACTATTGGC -3'
(R):5'- CGAGTTTGACTTGTCACCTGGC -3'

Sequencing Primer
(F):5'- TACTATTGGCCGGCGATCATACG -3'
(R):5'- ACTTGTCACCTGGCAGCCC -3'
Posted On2019-12-20