Incidental Mutation 'R7856:Ppp1r3a'
ID607233
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3A
SynonymsRGL, GM
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7856 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location14713977-14755274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14718026 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 963 (I963N)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
Predicted Effect probably benign
Transcript: ENSMUST00000045096
AA Change: I963N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: I963N

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Dusp7 C A 9: 106,368,868 A24E unknown Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14755084 missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14719060 missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14718408 missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14717852 missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14718609 missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14718346 missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14754811 missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14717715 missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14718600 missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14718459 missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14719762 missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14719811 missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14722065 splice site probably benign
IGL03290:Ppp1r3a APN 6 14754772 missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14719766 missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14719697 missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14717777 missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14717661 missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14754517 missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14718960 missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14719697 missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14754718 missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14717982 missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14754994 missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14718405 missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14718405 missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14722104 missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14721875 missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14718323 missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14719378 missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14719414 missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14719912 missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14719074 missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14719074 missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14719781 missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14754682 missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14718993 missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14719047 missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14754681 missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14719604 missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14719418 missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14719349 missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14719763 missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14719883 missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14718984 missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14718989 missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14719340 missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14754604 missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14718431 missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14719571 missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14718981 nonsense probably null
R6869:Ppp1r3a UTSW 6 14754826 missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14719236 missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14719191 missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14719070 missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14718750 missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14754978 missense probably benign 0.06
R7939:Ppp1r3a UTSW 6 14718026 missense probably benign 0.01
Z1177:Ppp1r3a UTSW 6 14755151 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GTAGCAGAAGCAGAGCTCAC -3'
(R):5'- CTCGGGACAGCTCTCAAGTTTAC -3'

Sequencing Primer
(F):5'- GAAGCAGAGCTCACTAATCCTTTGTC -3'
(R):5'- CAGTACCTTCTTACGGTGAAGAG -3'
Posted On2019-12-20