Incidental Mutation 'R7856:Yif1b'
ID607236
Institutional Source Beutler Lab
Gene Symbol Yif1b
Ensembl Gene ENSMUSG00000030588
Gene NameYip1 interacting factor homolog B (S. cerevisiae)
Synonyms9430029K10Rik
Accession Numbers

Ncbi RefSeq: NM_029887.3, NM_001110201.1; MGI:1924504

Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R7856 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29238329-29247597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29244620 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 137 (D137G)
Ref Sequence ENSEMBL: ENSMUSP00000103873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032808] [ENSMUST00000032809] [ENSMUST00000108237] [ENSMUST00000108238] [ENSMUST00000138128] [ENSMUST00000142519]
Predicted Effect probably benign
Transcript: ENSMUST00000032808
SMART Domains Protein: ENSMUSP00000032808
Gene: ENSMUSG00000030587

DomainStartEndE-ValueType
Pfam:IMUP 1 114 1.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032809
AA Change: D140G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032809
Gene: ENSMUSG00000030588
AA Change: D140G

DomainStartEndE-ValueType
low complexity region 45 65 N/A INTRINSIC
Pfam:YIF1 72 304 5.7e-86 PFAM
Pfam:Yip1 110 282 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108237
AA Change: D132G

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103872
Gene: ENSMUSG00000030588
AA Change: D132G

DomainStartEndE-ValueType
low complexity region 37 57 N/A INTRINSIC
Pfam:YIF1 64 176 3.9e-48 PFAM
Pfam:YIF1 169 244 2.5e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108238
AA Change: D137G

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103873
Gene: ENSMUSG00000030588
AA Change: D137G

DomainStartEndE-ValueType
low complexity region 42 62 N/A INTRINSIC
Pfam:YIF1 66 303 5.4e-107 PFAM
Pfam:Yip1 107 279 7.7e-11 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117224
Gene: ENSMUSG00000030588
AA Change: D152G

DomainStartEndE-ValueType
low complexity region 42 62 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142519
AA Change: D144G

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Meta Mutation Damage Score 0.3415 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
Allele List at MGI

All alleles(19) : Targeted(3) Gene trapped(16)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Dusp7 C A 9: 106,368,868 A24E unknown Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Yif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03172:Yif1b APN 7 29238448 splice site probably null
P0027:Yif1b UTSW 7 29238613 critical splice donor site probably null
R3605:Yif1b UTSW 7 29238410 missense possibly damaging 0.85
R3607:Yif1b UTSW 7 29238410 missense possibly damaging 0.85
R5244:Yif1b UTSW 7 29244441 missense probably damaging 1.00
R5432:Yif1b UTSW 7 29245968 missense probably damaging 0.99
R6221:Yif1b UTSW 7 29245782 missense possibly damaging 0.71
R7779:Yif1b UTSW 7 29245903 missense probably damaging 1.00
R7939:Yif1b UTSW 7 29244620 missense possibly damaging 0.59
R8090:Yif1b UTSW 7 29244301 missense probably benign 0.44
T0722:Yif1b UTSW 7 29238613 critical splice donor site probably null
U24488:Yif1b UTSW 7 29244169 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACGGTGTATGTGGGCAAG -3'
(R):5'- AGGATCCTTACCTGTCCTGG -3'

Sequencing Primer
(F):5'- TATGTGGGCAAGAAGCTTGG -3'
(R):5'- CGGCCACCAAGATGTAGGTG -3'
Posted On2019-12-20