Incidental Mutation 'R7856:Dusp7'
ID607242
Institutional Source Beutler Lab
Gene Symbol Dusp7
Ensembl Gene ENSMUSG00000053716
Gene Namedual specificity phosphatase 7
SynonymsPYST2, MKP-X
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R7856 (G1)
Quality Score186.009
Status Validated
Chromosome9
Chromosomal Location106368632-106375724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106368868 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 24 (A24E)
Ref Sequence ENSEMBL: ENSMUSP00000126984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172306]
Predicted Effect unknown
Transcript: ENSMUST00000172306
AA Change: A24E
SMART Domains Protein: ENSMUSP00000126984
Gene: ENSMUSG00000053716
AA Change: A24E

DomainStartEndE-ValueType
low complexity region 18 54 N/A INTRINSIC
RHOD 58 187 4.5e-11 SMART
low complexity region 195 213 N/A INTRINSIC
DSPc 247 387 8.53e-71 SMART
Blast:DSPc 393 416 8e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173748
SMART Domains Protein: ENSMUSP00000133511
Gene: ENSMUSG00000053716

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
DSPc 58 214 4.41e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. DUSP7 belongs to a class of DUSPs, designated MKPs, that dephosphorylate MAPK (mitogen-activated protein kinase) proteins ERK (see MIM 601795), JNK (see MIM 601158), and p38 (see MIM 600289) with specificity distinct from that of individual MKP proteins. MKPs contain a highly conserved C-terminal catalytic domain and an N-terminal Cdc25 (see MIM 116947)-like (CH2) domain. MAPK activation cascades mediate various physiologic processes, including cellular proliferation, apoptosis, differentiation, and stress responses (summary by Patterson et al., 2009 [PubMed 19228121]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Dusp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03181:Dusp7 APN 9 106373810 missense probably damaging 1.00
alessi UTSW 9 106373741 missense probably damaging 1.00
R1118:Dusp7 UTSW 9 106373650 missense possibly damaging 0.91
R1952:Dusp7 UTSW 9 106370829 missense probably benign 0.05
R2049:Dusp7 UTSW 9 106373897 missense probably damaging 1.00
R2408:Dusp7 UTSW 9 106369162 missense probably benign 0.30
R3852:Dusp7 UTSW 9 106373893 missense probably benign 0.00
R4632:Dusp7 UTSW 9 106370766 missense possibly damaging 0.64
R5022:Dusp7 UTSW 9 106373741 missense probably damaging 1.00
R6273:Dusp7 UTSW 9 106373896 missense possibly damaging 0.57
R6525:Dusp7 UTSW 9 106369284 missense possibly damaging 0.91
R7161:Dusp7 UTSW 9 106368915 missense unknown
R7575:Dusp7 UTSW 9 106373677 missense probably damaging 1.00
R7818:Dusp7 UTSW 9 106369130 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTCTGCAAGGCACAGATGTAG -3'
(R):5'- AATCTAGCAGCAGCAGGGAC -3'

Sequencing Primer
(F):5'- TCAGCCAGAGATCTGCGAG -3'
(R):5'- CTCTTGCAGGGCATGGC -3'
Posted On2019-12-20