Incidental Mutation 'R7856:Sash1'
ID 607243
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene Name SAM and SH3 domain containing 1
Synonyms A330076K04Rik, 2500002E12Rik, 1100001C18Rik
MMRRC Submission 045909-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7856 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 8597983-8761814 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8605472 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 973 (S973P)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000015449
AA Change: S973P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: S973P

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,608,451 (GRCm39) T819A probably damaging Het
Ccdc34 T A 2: 109,874,572 (GRCm39) Y310* probably null Het
Ccdc63 A G 5: 122,268,006 (GRCm39) W8R probably benign Het
Ces2g G A 8: 105,693,014 (GRCm39) V351I not run Het
Ces3b A G 8: 105,819,894 (GRCm39) *572W probably null Het
Dgka T C 10: 128,572,533 (GRCm39) N40S probably benign Het
Dnajc13 C A 9: 104,044,684 (GRCm39) R1835L possibly damaging Het
Dusp7 C A 9: 106,246,067 (GRCm39) A24E unknown Het
Ep400 T A 5: 110,814,450 (GRCm39) T2931S probably damaging Het
Gm4847 A T 1: 166,462,395 (GRCm39) L365Q probably damaging Het
Gtse1 C T 15: 85,748,342 (GRCm39) T249M probably benign Het
Hook3 T C 8: 26,525,249 (GRCm39) D619G probably damaging Het
Itsn1 T A 16: 91,705,375 (GRCm39) probably null Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Mx1 A G 16: 97,256,735 (GRCm39) I148T probably damaging Het
Or5m3 T A 2: 85,838,640 (GRCm39) N173K probably damaging Het
Or6c1b A G 10: 129,272,885 (GRCm39) E68G probably damaging Het
Orc3 T C 4: 34,585,647 (GRCm39) I416V probably benign Het
Plcxd3 A T 15: 4,546,581 (GRCm39) Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,025 (GRCm39) I963N probably benign Het
Ppp1r7 A G 1: 93,278,068 (GRCm39) D69G possibly damaging Het
Rars1 A G 11: 35,699,412 (GRCm39) V627A probably benign Het
Slc22a28 T C 19: 8,040,698 (GRCm39) T518A probably damaging Het
Slc4a9 C T 18: 36,661,751 (GRCm39) H92Y probably benign Het
Son A G 16: 91,456,146 (GRCm39) D1631G probably damaging Het
Stat5a T C 11: 100,774,728 (GRCm39) W746R unknown Het
Thsd4 A T 9: 59,910,144 (GRCm39) L508Q probably damaging Het
Tlx1 C T 19: 45,144,427 (GRCm39) Q292* probably null Het
Ttc34 T C 4: 154,945,743 (GRCm39) V259A probably benign Het
Xrn2 T G 2: 146,910,393 (GRCm39) probably null Het
Yif1b A G 7: 28,944,045 (GRCm39) D137G possibly damaging Het
Zfp850 A G 7: 27,689,899 (GRCm39) I103T probably benign Het
Zfp937 T C 2: 150,081,467 (GRCm39) V499A probably benign Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8,627,177 (GRCm39) missense probably damaging 1.00
IGL01535:Sash1 APN 10 8,617,341 (GRCm39) missense probably damaging 1.00
IGL01537:Sash1 APN 10 8,605,422 (GRCm39) missense probably damaging 1.00
IGL01788:Sash1 APN 10 8,609,410 (GRCm39) missense probably benign 0.01
IGL01933:Sash1 APN 10 8,626,897 (GRCm39) missense probably damaging 0.99
IGL02126:Sash1 APN 10 8,615,229 (GRCm39) missense probably damaging 0.96
IGL02285:Sash1 APN 10 8,616,098 (GRCm39) missense probably damaging 0.99
IGL02400:Sash1 APN 10 8,609,411 (GRCm39) nonsense probably null
IGL02504:Sash1 APN 10 8,605,676 (GRCm39) missense probably benign 0.00
IGL02630:Sash1 APN 10 8,620,299 (GRCm39) missense probably benign 0.06
boyscout UTSW 10 8,618,186 (GRCm39) splice site probably null
cubscout UTSW 10 8,605,477 (GRCm39) missense probably benign 0.01
R0592:Sash1 UTSW 10 8,605,546 (GRCm39) missense probably benign 0.00
R0647:Sash1 UTSW 10 8,605,316 (GRCm39) missense probably damaging 0.99
R0656:Sash1 UTSW 10 8,626,901 (GRCm39) critical splice donor site probably null
R0830:Sash1 UTSW 10 8,605,673 (GRCm39) missense probably benign 0.01
R0919:Sash1 UTSW 10 8,605,843 (GRCm39) missense probably benign 0.01
R1470:Sash1 UTSW 10 8,665,357 (GRCm39) missense probably damaging 1.00
R1470:Sash1 UTSW 10 8,665,357 (GRCm39) missense probably damaging 1.00
R1606:Sash1 UTSW 10 8,605,721 (GRCm39) missense probably benign 0.00
R1707:Sash1 UTSW 10 8,606,141 (GRCm39) missense probably benign 0.00
R1922:Sash1 UTSW 10 8,603,672 (GRCm39) missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8,605,696 (GRCm39) missense probably benign
R1964:Sash1 UTSW 10 8,605,477 (GRCm39) missense probably benign 0.01
R2013:Sash1 UTSW 10 8,605,177 (GRCm39) missense probably benign 0.03
R2014:Sash1 UTSW 10 8,605,177 (GRCm39) missense probably benign 0.03
R2015:Sash1 UTSW 10 8,605,177 (GRCm39) missense probably benign 0.03
R2074:Sash1 UTSW 10 8,632,461 (GRCm39) missense probably damaging 1.00
R2252:Sash1 UTSW 10 8,605,741 (GRCm39) missense probably benign 0.01
R2253:Sash1 UTSW 10 8,605,741 (GRCm39) missense probably benign 0.01
R2260:Sash1 UTSW 10 8,662,142 (GRCm39) nonsense probably null
R3085:Sash1 UTSW 10 8,618,186 (GRCm39) splice site probably null
R4024:Sash1 UTSW 10 8,605,681 (GRCm39) missense probably benign 0.00
R4039:Sash1 UTSW 10 8,605,391 (GRCm39) missense probably damaging 1.00
R4290:Sash1 UTSW 10 8,606,006 (GRCm39) missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8,606,006 (GRCm39) missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8,606,006 (GRCm39) missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8,627,234 (GRCm39) missense probably benign 0.00
R4657:Sash1 UTSW 10 8,601,424 (GRCm39) missense probably damaging 1.00
R4669:Sash1 UTSW 10 8,606,149 (GRCm39) missense probably benign 0.00
R4719:Sash1 UTSW 10 8,605,477 (GRCm39) missense probably benign 0.01
R4745:Sash1 UTSW 10 8,605,672 (GRCm39) missense probably benign
R5197:Sash1 UTSW 10 8,615,989 (GRCm39) missense probably damaging 1.00
R5217:Sash1 UTSW 10 8,656,368 (GRCm39) missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8,621,950 (GRCm39) missense probably damaging 1.00
R5591:Sash1 UTSW 10 8,601,482 (GRCm39) missense probably benign 0.36
R6505:Sash1 UTSW 10 8,605,291 (GRCm39) missense probably benign 0.21
R6679:Sash1 UTSW 10 8,615,949 (GRCm39) missense probably damaging 1.00
R6761:Sash1 UTSW 10 8,620,286 (GRCm39) missense probably damaging 0.99
R6885:Sash1 UTSW 10 8,659,985 (GRCm39) missense probably damaging 1.00
R6980:Sash1 UTSW 10 8,605,612 (GRCm39) missense probably benign 0.00
R7034:Sash1 UTSW 10 8,605,847 (GRCm39) nonsense probably null
R7036:Sash1 UTSW 10 8,605,847 (GRCm39) nonsense probably null
R7088:Sash1 UTSW 10 8,605,481 (GRCm39) nonsense probably null
R7289:Sash1 UTSW 10 8,605,960 (GRCm39) missense probably damaging 0.99
R7464:Sash1 UTSW 10 8,632,509 (GRCm39) missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8,605,155 (GRCm39) missense probably benign 0.01
R7752:Sash1 UTSW 10 8,656,328 (GRCm39) nonsense probably null
R7901:Sash1 UTSW 10 8,656,328 (GRCm39) nonsense probably null
R8152:Sash1 UTSW 10 8,626,805 (GRCm39) missense possibly damaging 0.94
R8218:Sash1 UTSW 10 8,627,000 (GRCm39) missense probably damaging 0.99
R8317:Sash1 UTSW 10 8,605,150 (GRCm39) missense possibly damaging 0.76
R8358:Sash1 UTSW 10 8,605,745 (GRCm39) missense probably benign
R8503:Sash1 UTSW 10 8,656,277 (GRCm39) splice site probably benign
R8696:Sash1 UTSW 10 8,609,459 (GRCm39) missense probably damaging 1.00
R8703:Sash1 UTSW 10 8,605,595 (GRCm39) missense probably damaging 0.99
R8710:Sash1 UTSW 10 8,656,285 (GRCm39) missense possibly damaging 0.82
R8822:Sash1 UTSW 10 8,761,615 (GRCm39) start gained probably benign
R8826:Sash1 UTSW 10 8,637,869 (GRCm39) start codon destroyed probably null
R8891:Sash1 UTSW 10 8,603,734 (GRCm39) missense probably damaging 1.00
R8968:Sash1 UTSW 10 8,606,179 (GRCm39) missense probably benign 0.00
R8984:Sash1 UTSW 10 8,626,808 (GRCm39) missense possibly damaging 0.46
R9194:Sash1 UTSW 10 8,615,969 (GRCm39) missense probably damaging 0.99
R9248:Sash1 UTSW 10 8,617,296 (GRCm39) missense probably damaging 1.00
R9405:Sash1 UTSW 10 8,637,994 (GRCm39) start gained probably benign
R9408:Sash1 UTSW 10 8,637,994 (GRCm39) start gained probably benign
R9489:Sash1 UTSW 10 8,605,169 (GRCm39) missense probably benign 0.05
R9576:Sash1 UTSW 10 8,620,299 (GRCm39) missense probably benign 0.06
R9632:Sash1 UTSW 10 8,615,969 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCACACCATGCTCCTG -3'
(R):5'- CTCCTCCTCAGTGTATACCCAGAG -3'

Sequencing Primer
(F):5'- TGCAGGCTAGTGCTCTCG -3'
(R):5'- TGTATACCCAGAGATTTCGAGGCC -3'
Posted On 2019-12-20