Incidental Mutation 'R7856:Olfr786'
ID607245
Institutional Source Beutler Lab
Gene Symbol Olfr786
Ensembl Gene ENSMUSG00000095696
Gene Nameolfactory receptor 786
SynonymsGA_x6K02T2PULF-11116958-11117896, MOR111-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7856 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129427306-129439080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129437016 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 68 (E68G)
Ref Sequence ENSEMBL: ENSMUSP00000145099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076508] [ENSMUST00000204529]
Predicted Effect probably damaging
Transcript: ENSMUST00000076508
AA Change: E68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075827
Gene: ENSMUSG00000095696
AA Change: E68G

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 7.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204529
AA Change: E68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145099
Gene: ENSMUSG00000095696
AA Change: E68G

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 7.3e-20 PFAM
Meta Mutation Damage Score 0.2705 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Dusp7 C A 9: 106,368,868 A24E unknown Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Olfr786
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Olfr786 APN 10 129437034 missense possibly damaging 0.95
IGL03027:Olfr786 APN 10 129436911 missense probably damaging 1.00
IGL03177:Olfr786 APN 10 129436815 start codon destroyed probably null 0.82
IGL03216:Olfr786 APN 10 129436937 missense probably damaging 0.98
IGL03265:Olfr786 APN 10 129436925 missense possibly damaging 0.83
R0080:Olfr786 UTSW 10 129437271 missense possibly damaging 0.85
R0082:Olfr786 UTSW 10 129437271 missense possibly damaging 0.85
R0242:Olfr786 UTSW 10 129437348 missense probably damaging 1.00
R0242:Olfr786 UTSW 10 129437348 missense probably damaging 1.00
R0507:Olfr786 UTSW 10 129437288 missense probably benign 0.00
R1432:Olfr786 UTSW 10 129436938 missense probably damaging 1.00
R1563:Olfr786 UTSW 10 129437711 missense probably benign
R2023:Olfr786 UTSW 10 129437582 missense probably damaging 0.99
R2142:Olfr786 UTSW 10 129437747 missense probably benign 0.14
R2279:Olfr786 UTSW 10 129437657 missense probably benign 0.07
R3412:Olfr786 UTSW 10 129437307 missense probably damaging 0.99
R4467:Olfr786 UTSW 10 129437064 missense probably benign 0.04
R4529:Olfr786 UTSW 10 129437418 missense probably benign 0.03
R4843:Olfr786 UTSW 10 129437447 missense probably benign 0.01
R4888:Olfr786 UTSW 10 129437379 missense possibly damaging 0.95
R4890:Olfr786 UTSW 10 129437079 missense probably benign 0.08
R6255:Olfr786 UTSW 10 129437688 missense possibly damaging 0.95
R6362:Olfr786 UTSW 10 129436943 missense probably damaging 1.00
R6705:Olfr786 UTSW 10 129437072 missense probably benign 0.00
R7270:Olfr786 UTSW 10 129437450 missense probably benign
R7450:Olfr786 UTSW 10 129437429 missense probably benign 0.00
R7803:Olfr786 UTSW 10 129436931 missense probably damaging 1.00
X0052:Olfr786 UTSW 10 129437499 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTGGGATTGTCAGATGACCC -3'
(R):5'- GCAAAGACCAACATTTTGCAG -3'

Sequencing Primer
(F):5'- CCAAAGCTCCAGGTTGTGATC -3'
(R):5'- AGACCTTCTGACTCATGATGGTCAG -3'
Posted On2019-12-20