Incidental Mutation 'R7856:Rars'
ID607246
Institutional Source Beutler Lab
Gene Symbol Rars
Ensembl Gene ENSMUSG00000018848
Gene Namearginyl-tRNA synthetase
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7856 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location35808381-35834506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35808585 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 627 (V627A)
Ref Sequence ENSEMBL: ENSMUSP00000018992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018992]
Predicted Effect probably benign
Transcript: ENSMUST00000018992
AA Change: V627A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000018992
Gene: ENSMUSG00000018848
AA Change: V627A

DomainStartEndE-ValueType
Blast:Arg_tRNA_synt_N 16 60 6e-13 BLAST
Arg_tRNA_synt_N 78 166 1.6e-27 SMART
Pfam:tRNA-synt_1d 174 520 1.2e-164 PFAM
DALR_1 534 660 3.12e-30 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Dusp7 C A 9: 106,368,868 A24E unknown Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Plcxd3 A T 15: 4,517,099 Y195F probably damaging Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Rars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Rars APN 11 35825981 splice site probably benign
IGL01672:Rars APN 11 35808553 missense probably damaging 0.99
IGL01721:Rars APN 11 35828664 missense probably damaging 1.00
IGL01887:Rars APN 11 35825995 missense probably benign 0.03
IGL02605:Rars APN 11 35824526 splice site probably benign
IGL03296:Rars APN 11 35816696 nonsense probably null
IGL03354:Rars APN 11 35824475 missense probably damaging 1.00
R0410:Rars UTSW 11 35826020 missense probably damaging 1.00
R1193:Rars UTSW 11 35809326 missense possibly damaging 0.92
R1222:Rars UTSW 11 35809740 missense probably damaging 1.00
R1418:Rars UTSW 11 35809740 missense probably damaging 1.00
R1562:Rars UTSW 11 35821094 critical splice donor site probably null
R1768:Rars UTSW 11 35809638 missense probably damaging 1.00
R1800:Rars UTSW 11 35825995 missense probably benign 0.03
R2055:Rars UTSW 11 35826583 splice site probably benign
R2294:Rars UTSW 11 35817536 splice site probably benign
R4281:Rars UTSW 11 35821224 missense probably damaging 1.00
R4807:Rars UTSW 11 35809146 missense possibly damaging 0.81
R4898:Rars UTSW 11 35808558 missense probably damaging 1.00
R5522:Rars UTSW 11 35817368 nonsense probably null
R5907:Rars UTSW 11 35828648 missense probably damaging 1.00
R6243:Rars UTSW 11 35826547 missense possibly damaging 0.64
R6289:Rars UTSW 11 35826067 missense probably damaging 1.00
R6550:Rars UTSW 11 35833183 missense probably benign 0.00
R6889:Rars UTSW 11 35808486 missense probably damaging 1.00
R7260:Rars UTSW 11 35834454 missense probably benign 0.00
R7682:Rars UTSW 11 35828752 missense probably benign 0.00
R7808:Rars UTSW 11 35828707 missense probably benign
R7822:Rars UTSW 11 35819966 missense probably damaging 0.99
R7939:Rars UTSW 11 35808585 missense probably benign 0.09
R8029:Rars UTSW 11 35821165 missense probably damaging 1.00
Z1177:Rars UTSW 11 35826109 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACACACCTGGCATAGCTGTG -3'
(R):5'- CGTGTAGCCTTAGGAAAGCAC -3'

Sequencing Primer
(F):5'- CACCTGGCATAGCTGTGAAAATTC -3'
(R):5'- AAGCACTGCAGGTTTCATGG -3'
Posted On2019-12-20