Incidental Mutation 'R7856:Plcxd3'
ID607248
Institutional Source Beutler Lab
Gene Symbol Plcxd3
Ensembl Gene ENSMUSG00000049148
Gene Namephosphatidylinositol-specific phospholipase C, X domain containing 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7856 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4375491-4575553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4517099 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 195 (Y195F)
Ref Sequence ENSEMBL: ENSMUSP00000053553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061925]
Predicted Effect probably damaging
Transcript: ENSMUST00000061925
AA Change: Y195F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053553
Gene: ENSMUSG00000049148
AA Change: Y195F

DomainStartEndE-ValueType
SCOP:d2ptd__ 2 311 2e-62 SMART
PDB:1AOD|A 7 166 1e-8 PDB
Blast:PLCXc 23 148 3e-17 BLAST
Meta Mutation Damage Score 0.3322 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h T C 17: 25,389,477 T819A probably damaging Het
Ccdc34 T A 2: 110,044,227 Y310* probably null Het
Ccdc63 A G 5: 122,129,943 W8R probably benign Het
Ces2g G A 8: 104,966,382 V351I not run Het
Ces3b A G 8: 105,093,262 *572W probably null Het
Dgka T C 10: 128,736,664 N40S probably benign Het
Dnajc13 C A 9: 104,167,485 R1835L possibly damaging Het
Dusp7 C A 9: 106,368,868 A24E unknown Het
Ep400 T A 5: 110,666,584 T2931S probably damaging Het
Gm4847 A T 1: 166,634,826 L365Q probably damaging Het
Gtse1 C T 15: 85,864,141 T249M probably benign Het
Hook3 T C 8: 26,035,221 D619G probably damaging Het
Itsn1 T A 16: 91,908,487 probably null Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mx1 A G 16: 97,455,535 I148T probably damaging Het
Olfr1032 T A 2: 86,008,296 N173K probably damaging Het
Olfr786 A G 10: 129,437,016 E68G probably damaging Het
Orc3 T C 4: 34,585,647 I416V probably benign Het
Ppp1r3a A T 6: 14,718,026 I963N probably benign Het
Ppp1r7 A G 1: 93,350,346 D69G possibly damaging Het
Rars A G 11: 35,808,585 V627A probably benign Het
Sash1 A G 10: 8,729,708 S973P probably benign Het
Slc22a28 T C 19: 8,063,333 T518A probably damaging Het
Slc4a9 C T 18: 36,528,698 H92Y probably benign Het
Son A G 16: 91,659,258 D1631G probably damaging Het
Stat5a T C 11: 100,883,902 W746R unknown Het
Thsd4 A T 9: 60,002,861 L508Q probably damaging Het
Tlx1 C T 19: 45,155,988 Q292* probably null Het
Ttc34 T C 4: 154,861,286 V259A probably benign Het
Xrn2 T G 2: 147,068,473 probably null Het
Yif1b A G 7: 29,244,620 D137G possibly damaging Het
Zfp850 A G 7: 27,990,474 I103T probably benign Het
Zfp937 T C 2: 150,239,547 V499A probably benign Het
Other mutations in Plcxd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Plcxd3 APN 15 4516640 missense possibly damaging 0.91
IGL02743:Plcxd3 APN 15 4574803 missense possibly damaging 0.92
IGL03230:Plcxd3 APN 15 4516790 missense probably damaging 0.99
R0599:Plcxd3 UTSW 15 4516867 missense probably damaging 0.96
R0724:Plcxd3 UTSW 15 4516868 missense probably damaging 0.99
R0939:Plcxd3 UTSW 15 4516862 nonsense probably null
R1536:Plcxd3 UTSW 15 4516611 splice site probably benign
R1648:Plcxd3 UTSW 15 4375809 missense probably benign
R1858:Plcxd3 UTSW 15 4516611 splice site probably benign
R2418:Plcxd3 UTSW 15 4574763 missense probably benign 0.04
R2419:Plcxd3 UTSW 15 4574763 missense probably benign 0.04
R4640:Plcxd3 UTSW 15 4517243 missense probably damaging 0.99
R4702:Plcxd3 UTSW 15 4375787 missense probably benign
R5372:Plcxd3 UTSW 15 4574788 missense probably benign
R5705:Plcxd3 UTSW 15 4517194 missense probably benign 0.43
R6302:Plcxd3 UTSW 15 4516757 missense probably damaging 1.00
R7050:Plcxd3 UTSW 15 4516718 missense probably damaging 0.96
R7283:Plcxd3 UTSW 15 4516919 missense probably damaging 0.97
R7939:Plcxd3 UTSW 15 4517099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATTCAGTGCCAAAGTCAACGAG -3'
(R):5'- CTTGCTTTGGGTGTCAGCAC -3'

Sequencing Primer
(F):5'- CCACCACAAAGAGGTAGTATTCTTGG -3'
(R):5'- GTGTCAGCACCACCTGAG -3'
Posted On2019-12-20